ID: 1175524282

View in Genome Browser
Species Human (GRCh38)
Location 20:59622818-59622840
Sequence CAGGATGTGCATCTCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175524282_1175524287 13 Left 1175524282 20:59622818-59622840 CCCACCAGGAGATGCACATCCTG 0: 1
1: 0
2: 4
3: 9
4: 189
Right 1175524287 20:59622854-59622876 AACTGCTATCCAGAGTGTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 125
1175524282_1175524289 26 Left 1175524282 20:59622818-59622840 CCCACCAGGAGATGCACATCCTG 0: 1
1: 0
2: 4
3: 9
4: 189
Right 1175524289 20:59622867-59622889 AGTGTCTGGGCTTATCCTGTTGG 0: 1
1: 0
2: 2
3: 17
4: 152
1175524282_1175524286 12 Left 1175524282 20:59622818-59622840 CCCACCAGGAGATGCACATCCTG 0: 1
1: 0
2: 4
3: 9
4: 189
Right 1175524286 20:59622853-59622875 GAACTGCTATCCAGAGTGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175524282 Original CRISPR CAGGATGTGCATCTCCTGGT GGG (reversed) Intronic
907189824 1:52639248-52639270 CAGGATGTGGATGTCCTGTCTGG - Intronic
907243146 1:53091629-53091651 CAGGAGGTGCATCTGCTGCCAGG + Intronic
908823973 1:68115963-68115985 CAAGCTCTGCACCTCCTGGTCGG + Intronic
911143038 1:94526069-94526091 CAGGATGTTTATCTTCTGCTAGG + Intergenic
911675803 1:100656774-100656796 CAAGAAGTTGATCTCCTGGTTGG + Intergenic
912506591 1:110161002-110161024 CAGGACTTGCAACACCTGGTGGG + Intronic
913703628 1:121397279-121397301 CAGGGTCTGTATCTCCTGCTGGG - Intergenic
913979979 1:143498990-143499012 CAGGGTCTGTATCTCCTGCTGGG - Intergenic
915039206 1:152953782-152953804 CAGGATGTGCATCTAGCAGTGGG - Intergenic
919469228 1:197958150-197958172 CAAGATGTGTGTCTGCTGGTGGG + Intergenic
922472814 1:225887416-225887438 CAGGGTGTGCAGCTCCAGCTGGG + Exonic
922480826 1:225939378-225939400 CAGGGTGTGCAGCTCCAGCTGGG + Exonic
923138628 1:231141032-231141054 CAGGATGTGACGCCCCTGGTAGG + Intergenic
923720226 1:236460661-236460683 CAGACTGTGAATCTCCTGTTGGG - Intronic
1063856429 10:10259302-10259324 CAGGAGGAGCATCCCCTGGTTGG + Intergenic
1067055129 10:43045627-43045649 CAGGGTGTGGATCTCCATGTGGG + Intergenic
1068685572 10:59867190-59867212 CAAGATGTGAACCTCCAGGTTGG - Intronic
1070733920 10:78850734-78850756 CAGGGTCTGCATCTCCAGGTTGG + Intergenic
1071279670 10:84089046-84089068 AAGAATGTGCTTCACCTGGTTGG - Intergenic
1071529080 10:86375421-86375443 CAGGCTGTGCATGCCCTGCTTGG - Intergenic
1074483968 10:113854961-113854983 CAGGCTGTCCTTCTCCTGCTGGG - Exonic
1075038759 10:119091031-119091053 CATGAAGTGCAGCTCCTGCTTGG + Intergenic
1075930729 10:126293207-126293229 CTGGATGTGCAGCTTCTGGGAGG + Intronic
1076614648 10:131747515-131747537 CAGGAGGTGCGTCCCCTGGCTGG - Intergenic
1078468373 11:11567621-11567643 AGTGATGGGCATCTCCTGGTGGG - Intronic
1079244425 11:18742489-18742511 CAGGAGGTGCCACACCTGGTTGG + Exonic
1083340831 11:61957379-61957401 CAAGGTGTTCATCTCCTGGGGGG - Exonic
1083431299 11:62614794-62614816 TGGGAGGTGCTTCTCCTGGTGGG - Exonic
1083827513 11:65211807-65211829 CAGGCTGGGCAGCTCCTGGTCGG - Exonic
1084958234 11:72702854-72702876 CAGGCTGTGCAGTGCCTGGTGGG - Intronic
1086199993 11:84190697-84190719 CAGATTGTGCATCTCCTAATAGG - Intronic
1088623574 11:111711607-111711629 CAGGCTGTGCATCTCCTTGAAGG + Intronic
1091044360 11:132312546-132312568 CAGGCTTTGCAGCTCCTGGGAGG - Intronic
1091098809 11:132850202-132850224 CAGGATGTGCATCTCATGGAAGG + Intronic
1091114153 11:132997936-132997958 CAGGATGTGAACCTCCTGTGAGG - Intronic
1093294292 12:17368562-17368584 CAGGTTTTGCAACTACTGGTAGG - Intergenic
1093576046 12:20731031-20731053 CAGGATGGCCATCTCCGGGGTGG - Intronic
1093876569 12:24355467-24355489 TAGGATGTGTATCTCCAGGGAGG - Intergenic
1095943681 12:47741500-47741522 CAGGAAGTGCATGAGCTGGTAGG - Exonic
1097473840 12:60029224-60029246 CAAGATGTGAATCTTGTGGTTGG + Intergenic
1097662255 12:62444044-62444066 CAGGATGTGAAATTCTTGGTTGG + Intergenic
1099098072 12:78400578-78400600 CAGTAGGTGCATCAGCTGGTGGG - Intergenic
1099929222 12:89053965-89053987 CATGATTTGCACCTCCTTGTGGG - Intergenic
1100246115 12:92758491-92758513 CTGGAGGAGCAGCTCCTGGTGGG + Intronic
1102151317 12:110690369-110690391 TAGGATGTGGATATCTTGGTAGG + Intronic
1102599719 12:114020564-114020586 CAGCATCAGCATCACCTGGTAGG + Intergenic
1104436522 12:128761335-128761357 CTGAATGTGCTTCTCCTTGTTGG - Intergenic
1105013705 12:132773276-132773298 CAGGCTGTCCATCTCCTGCCTGG + Exonic
1111668453 13:91299318-91299340 CAGGTTATGCATCCCCAGGTGGG + Intergenic
1113469192 13:110532330-110532352 CAGTGTTTGCATTTCCTGGTAGG - Intronic
1113716234 13:112510061-112510083 CAGGATGCACATCTCCTGCAGGG + Intronic
1114315206 14:21503469-21503491 TAGGATGTGCATCATCTTGTAGG + Exonic
1114671345 14:24413041-24413063 CAGGATGTGAATCTGCTCATTGG - Exonic
1117497254 14:56318022-56318044 CAGGATGAACAGTTCCTGGTGGG - Intergenic
1117890013 14:60410342-60410364 CAGGATGTGAAATTCTTGGTTGG + Intronic
1118984570 14:70742478-70742500 CAGGATGTCAATCTCCCGCTCGG + Exonic
1121493721 14:94378010-94378032 CAGGATGAGCAACTCTGGGTGGG + Exonic
1124220062 15:27843613-27843635 CTGAATGTGCGTCTCCCGGTGGG - Intronic
1125429865 15:39582869-39582891 CAGCATGAGCATCACCTGGAGGG + Intronic
1126380255 15:48039181-48039203 CAGGATGTGCCTATGCTGCTGGG + Intergenic
1126945490 15:53814420-53814442 AAGGAAGTGCATCTCATGTTAGG - Intergenic
1129367516 15:75065604-75065626 CAGGAAGTGCAGCTGCAGGTTGG + Intronic
1129456010 15:75676541-75676563 CAGTATGGGCATCTCCTGGTGGG - Exonic
1131335429 15:91544455-91544477 GAGGATGTGGATCTCCTCTTGGG + Intergenic
1131371060 15:91882272-91882294 CAGGATGTGCATTTGCTGAGTGG + Intronic
1131804672 15:96109037-96109059 CTGGATTTGCATCTTCTGGATGG - Intergenic
1136699300 16:32116904-32116926 CAGGGTCTGTATCTCCTGCTGGG - Intergenic
1136768350 16:32811030-32811052 CAGGGTCTGTATCTCCTGCTGGG + Intergenic
1136799791 16:33060075-33060097 CAGGGTCTGTATCTCCTGCTGGG - Intergenic
1136902218 16:34051338-34051360 CAGGGTCTGTATCTCCTGCTGGG - Intergenic
1138381726 16:56607525-56607547 CAGGATGTGCCTCTCCAGACAGG + Intergenic
1141715097 16:85722460-85722482 CTGGATTTGCAGCTCCAGGTAGG + Intronic
1142223656 16:88867044-88867066 CAGGCCCTGCCTCTCCTGGTCGG - Intergenic
1203070742 16_KI270728v1_random:1073046-1073068 CAGGGTCTGTATCTCCTGCTGGG + Intergenic
1144625755 17:16843709-16843731 CTCAATGTGCATCTCCAGGTCGG + Intergenic
1144880677 17:18429011-18429033 CTCAATGTGCATCTCCGGGTCGG - Intergenic
1145151560 17:20515376-20515398 CTCAATGTGCATCTCCGGGTCGG + Intergenic
1145311257 17:21702271-21702293 CAGGTTCTGCATGTCCTGGGGGG + Intronic
1145359104 17:22197350-22197372 CAGGATCTGAAACTCTTGGTTGG + Intergenic
1145857428 17:28174843-28174865 CAGGATATGCATCATGTGGTTGG - Intronic
1146508489 17:33425852-33425874 CAGGATGTGCATATTTTGCTAGG + Intronic
1146694497 17:34898329-34898351 CAGGAGCTGCAGCTCCTGTTTGG - Intergenic
1147490867 17:40864851-40864873 CTCGATCTGCATCTCCAGGTCGG + Exonic
1152473061 17:80500876-80500898 CAGAACATGCATCTCCTGGGAGG - Intergenic
1156396950 18:36707347-36707369 CAGGTTGTGCATCTTCTACTGGG - Intronic
1159403945 18:67975907-67975929 CAAGATATGCATTTCTTGGTTGG + Intergenic
1159871877 18:73767586-73767608 GAGGATGTGGACATCCTGGTTGG + Intergenic
1161238829 19:3210753-3210775 CAGGTTGTGCAGGGCCTGGTGGG + Intergenic
1161625418 19:5323697-5323719 CAGGTTGTGCAAGGCCTGGTGGG + Intronic
1165141986 19:33705162-33705184 GAGGAGGTGGGTCTCCTGGTGGG + Intronic
1165488631 19:36110661-36110683 CAGGCTGTGCATCCTCAGGTAGG - Intergenic
1166074899 19:40408272-40408294 CAGGATGTGAAGCTCCAGGCAGG + Intronic
1167531557 19:50020856-50020878 CAGGATGCGCACGTTCTGGTGGG + Intronic
1168423934 19:56223661-56223683 CAGGATCTGCAGCTCTCGGTGGG + Exonic
1168725991 19:58582337-58582359 CAGGATGGGCAGCCCCTTGTAGG - Intergenic
1202647165 1_KI270706v1_random:153034-153056 CTGGAGGTGCATGGCCTGGTCGG + Intergenic
925463263 2:4083461-4083483 CAGGAGCTGCATGTCCTGCTTGG + Intergenic
926391150 2:12394238-12394260 CAGCATGGGCAGCTTCTGGTGGG + Intergenic
929498615 2:42469837-42469859 CAGGAAGGGCCTGTCCTGGTTGG + Intronic
930686545 2:54314070-54314092 CAGATTGTGCATGGCCTGGTAGG - Intergenic
931445121 2:62320775-62320797 CAGGGAGTGAATCTCCAGGTTGG - Intergenic
931771554 2:65502096-65502118 CAGGATGAGGAGCGCCTGGTTGG + Intergenic
933230231 2:79798333-79798355 CACAATGTGAGTCTCCTGGTGGG + Intronic
938548077 2:132353089-132353111 CTGGAGGTGCATGGCCTGGTCGG - Intergenic
938750064 2:134319986-134320008 CAGGAAGAACATCTACTGGTGGG - Intronic
938951117 2:136255597-136255619 CAGCATCAGCATCTCCTGTTTGG + Intergenic
942382260 2:175404073-175404095 CAGGATATGTGTCTTCTGGTTGG + Intergenic
944384227 2:199147047-199147069 CAGAACTTGCATCTCCTTGTTGG + Intergenic
944884447 2:204048362-204048384 CAAGATGTTCATCTAGTGGTAGG - Intergenic
948607032 2:239142431-239142453 AGGGTTGTGCATCTCCTGGCCGG - Intronic
948622355 2:239244382-239244404 CAGGAGGTGCAGGTCTTGGTGGG - Intronic
1170356464 20:15497264-15497286 CAGGATGGGCATTTCCTGTTAGG - Intronic
1171876946 20:30585861-30585883 CTGGAGGTGCATGGCCTGGTCGG - Intergenic
1173810794 20:45953895-45953917 CAGGGTTAGCATCCCCTGGTGGG - Exonic
1175524282 20:59622818-59622840 CAGGATGTGCATCTCCTGGTGGG - Intronic
1175664629 20:60847935-60847957 CAGGATCTGCCACTCCTGGTAGG + Intergenic
1176604705 21:8819740-8819762 CTGGAGGTGCATGGCCTGGTCGG - Intergenic
1177194959 21:17894432-17894454 CAGTATGTGCATCTTATTGTGGG + Intergenic
1178668321 21:34568065-34568087 CAGGATGTGAGCCTCCTGCTTGG + Intronic
1179933623 21:44589656-44589678 CAGGGAGGACATCTCCTGGTGGG - Intronic
1180009515 21:45040380-45040402 AAGGATGTGCATTGCCTGGAGGG - Intergenic
1180346995 22:11711345-11711367 CTGGAGGTGCATGGCCTGGTCGG - Intergenic
1180354741 22:11829435-11829457 CTGGAGGTGCATGGCCTGGTCGG - Intergenic
1180383511 22:12162897-12162919 CTGGAGGTGCATGGCCTGGTCGG + Intergenic
1182120466 22:27783107-27783129 CACGACGTACATCCCCTGGTTGG - Intronic
1184544564 22:45158055-45158077 CAGGATAGGCAACCCCTGGTTGG - Intergenic
1185028226 22:48427634-48427656 CAGGAGGGGCATCTCTGGGTGGG - Intergenic
950530725 3:13550997-13551019 CAGGATCTGCATCTCCTGGCTGG + Intronic
952916912 3:38253276-38253298 CAAGATGTCCATATCCTGGCAGG - Exonic
958930192 3:100199404-100199426 CAGGAGGCCCACCTCCTGGTAGG + Intergenic
959395431 3:105831364-105831386 AAGGATGGGGATCTCCAGGTGGG + Intronic
960504263 3:118473628-118473650 TAGCCTTTGCATCTCCTGGTAGG + Intergenic
968947026 4:3670556-3670578 CAGGCTGTGCATCCCCTGTGAGG + Intergenic
973373419 4:49271197-49271219 CTGGAAGTGCATGGCCTGGTCGG + Intergenic
973387593 4:49524011-49524033 CTGGAAGTGCATGGCCTGGTCGG - Intergenic
974155910 4:58072272-58072294 CAAGATGTGCATCTCCTATTTGG + Intergenic
974532534 4:63128311-63128333 CAGGATGTGACTCTGGTGGTTGG - Intergenic
975913838 4:79298828-79298850 CGGGATGTCCATTTCCTGGCTGG - Intronic
978377231 4:108087725-108087747 CCAGATGTGCACCTCCTGCTCGG + Intronic
992182050 5:74207121-74207143 CAGCATGTGCAGCTCCTGCCTGG + Intergenic
997427551 5:133814266-133814288 CAGGATGTGCATCCTCCGGTTGG + Intergenic
998964628 5:147525684-147525706 TTGGAAGTGAATCTCCTGGTTGG + Intergenic
1000155719 5:158549691-158549713 CAGCTTGTGCCTCTCCTGTTAGG - Intergenic
1001293543 5:170483296-170483318 CAGGAGTTGCATCTCCTCCTGGG - Intronic
1002577245 5:180181157-180181179 CAGGATGTGCCAGTCCTGCTGGG + Intronic
1006384896 6:33725280-33725302 CAGGGTATGCATTTCCTTGTTGG + Intronic
1008936948 6:57001611-57001633 CAGGATATGTACCTCTTGGTTGG - Intronic
1011314501 6:86016627-86016649 CAGGATTTTGAGCTCCTGGTGGG + Intergenic
1012221432 6:96653627-96653649 CCAAATATGCATCTCCTGGTGGG - Intergenic
1014800680 6:125774781-125774803 CAGGCTGGGCATATCCTGTTTGG + Intergenic
1014817178 6:125948964-125948986 CAAAATGTGTATCTCCAGGTTGG + Intergenic
1018233090 6:161694909-161694931 CGGGATCAGAATCTCCTGGTGGG + Intronic
1019003816 6:168779516-168779538 CGGGATGTGCATCTTAGGGTAGG - Intergenic
1019368136 7:645762-645784 CCGGATGTGCGTCTACTGGGAGG + Intronic
1022481393 7:30745366-30745388 GAGGCTGTGAAACTCCTGGTGGG - Intronic
1022551331 7:31242268-31242290 CAGCATCTGCATCTTTTGGTTGG - Intergenic
1023951374 7:44848504-44848526 TTGGACGTGCTTCTCCTGGTGGG + Intergenic
1025481917 7:60992887-60992909 CAGGGTCTGTATCTCCTGCTGGG - Intergenic
1025562043 7:62380979-62381001 CAGGGTCTGTATCTCCTGCTGGG - Intergenic
1029716310 7:102329009-102329031 CAGCATGTACAACCCCTGGTGGG - Intergenic
1029722945 7:102382215-102382237 CAGCATGTACAACCCCTGGTGGG - Intronic
1031509829 7:122636367-122636389 CAGGATATGAATTTCATGGTTGG + Intronic
1032088153 7:128894279-128894301 CTGGATGTGACCCTCCTGGTGGG + Exonic
1034130524 7:148711971-148711993 CCAGATGTGCACCTCCTGGCAGG - Intronic
1035650459 8:1260250-1260272 CATGATATGCATTCCCTGGTGGG - Intergenic
1035719796 8:1783435-1783457 CAGGATGTGGCTCTCCAGCTTGG + Exonic
1037738951 8:21589932-21589954 CATGCTGTGCATGTCCTGGCAGG + Intergenic
1038378602 8:27070021-27070043 TAGCATGTGCTGCTCCTGGTGGG + Intergenic
1038527848 8:28292142-28292164 CATGATGTACATCCCTTGGTTGG - Intergenic
1041321075 8:56613040-56613062 CAGGATCTGCTACTCCAGGTAGG + Intergenic
1041730903 8:61061702-61061724 CAGAATGTGGAGCTCCTGTTTGG + Intronic
1042175546 8:66034363-66034385 CTGTATGTCCATCTGCTGGTGGG - Intronic
1044803824 8:95984236-95984258 CAGCAGGGGCATCTGCTGGTGGG + Intergenic
1045211524 8:100105035-100105057 GTGGCTGTGCATTTCCTGGTTGG - Intronic
1046872630 8:119220626-119220648 CAGGAGGGGCATGTGCTGGTGGG - Intronic
1050262362 9:3854088-3854110 CAGGCTGTGCATCTACTGCCTGG + Intronic
1053503529 9:38621360-38621382 CTGGAGGTGCATGGCCTGGTCGG + Intergenic
1053680480 9:40482495-40482517 CAAGATGTGTCTCTGCTGGTGGG - Intergenic
1053752807 9:41273599-41273621 CTGGAGGTGCATGGCCTGGTCGG + Intergenic
1053930469 9:43110806-43110828 CAAGATGTGTCTCTGCTGGTGGG - Intergenic
1054258331 9:62837951-62837973 CTGGAGGTGCATGGCCTGGTCGG + Intergenic
1054283232 9:63142440-63142462 CAAGATGTGTCTCTGCTGGTGGG + Intergenic
1054293565 9:63318010-63318032 CAAGATGTGTCTCTGCTGGTGGG - Intergenic
1054333438 9:63782090-63782112 CTGGAGGTGCATGGCCTGGTCGG - Intergenic
1054391587 9:64622499-64622521 CAAGATGTGTCTCTGCTGGTGGG - Intergenic
1054504141 9:65893829-65893851 CAAGATGTGTCTCTGCTGGTGGG + Intronic
1056373041 9:85978105-85978127 CAGGATGTCCAGATCCTGTTAGG - Intronic
1057152598 9:92808535-92808557 CTGGAGGTGCATGACCTGGTCGG - Intergenic
1057684843 9:97222314-97222336 CTGGAGGTGCATGGCCTGGTCGG + Intergenic
1057840380 9:98481311-98481333 CAGGATTTGCCTGCCCTGGTGGG - Intronic
1058802292 9:108556499-108556521 CAGGATGTGAACCTCGTGTTGGG - Intergenic
1060134155 9:121135632-121135654 CAGGTTGTGCATATCCTGGTTGG - Intronic
1062520646 9:136956358-136956380 CATCATGTGCACCTCCTGCTGGG + Intronic
1202800443 9_KI270719v1_random:170424-170446 CTGGAGGTGCATGGCCTGGTCGG - Intergenic
1202800889 9_KI270719v1_random:174706-174728 CTGGAGGTGCATGGCCTGGTCGG - Intergenic
1203697129 Un_GL000214v1:109200-109222 CTGGAGGTGCATGGCCTGGTCGG + Intergenic
1203552084 Un_KI270743v1:171829-171851 CTGGAAGTGCATGGCCTGGTCGG - Intergenic
1185724476 X:2408398-2408420 CAGGAGGTGCCTCTGCTGGTTGG - Intronic
1194950962 X:100125229-100125251 CATGAAGTGATTCTCCTGGTAGG - Intergenic
1198703624 X:139423125-139423147 CCGGATGTGCATTTCCTTCTTGG - Intergenic
1199880305 X:151969178-151969200 CAGGAGGTGCATCACTTGGGAGG + Intronic
1200115756 X:153769069-153769091 CAGGATGGCCCTCACCTGGTGGG - Exonic
1200932266 Y:8707748-8707770 CATGATGTGAAGCTCCTGCTTGG + Intergenic