ID: 1175524817

View in Genome Browser
Species Human (GRCh38)
Location 20:59626368-59626390
Sequence GAGGAATGAGACTGGCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 629
Summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 571}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175524810_1175524817 3 Left 1175524810 20:59626342-59626364 CCTGGAGTGATGATAAAGTGAGG 0: 1
1: 0
2: 0
3: 15
4: 124
Right 1175524817 20:59626368-59626390 GAGGAATGAGACTGGCAGGGAGG 0: 1
1: 0
2: 7
3: 50
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175524817 Original CRISPR GAGGAATGAGACTGGCAGGG AGG Intronic
900391533 1:2436037-2436059 GAGGAAGGAGAGAGGAAGGGAGG - Intronic
900565977 1:3332036-3332058 GAGCAGGGAGCCTGGCAGGGTGG - Intronic
900744653 1:4352838-4352860 GTGGAGTGAGACTGGCAGGAAGG + Intergenic
901176081 1:7300287-7300309 CAGGAATGAGCCTGGAAGGGAGG - Intronic
901376799 1:8845419-8845441 ATGGACTGAGACTGGGAGGGGGG - Intergenic
901870320 1:12135018-12135040 TAGGAATGAGAGTGGCAGCCAGG + Intronic
902213208 1:14918386-14918408 GAGGAATGGGGCTGGCATGGTGG + Intronic
902246656 1:15125098-15125120 GAGAAATGGGAATGGTAGGGTGG - Intergenic
902963120 1:19978589-19978611 GAGGAAGGAGAGTAGCAGAGAGG - Intronic
903480279 1:23648035-23648057 GTGGGCTGAGACTGCCAGGGTGG - Intergenic
904313639 1:29645776-29645798 GAGGAATGAGAATAACAGGAGGG + Intergenic
904350998 1:29906712-29906734 GTGGAAGGAGCCGGGCAGGGTGG - Intergenic
905146886 1:35893857-35893879 GAGGGATGAGGCTGGGAGTGTGG - Intronic
906118732 1:43373223-43373245 GAGGAGTGAGTCAGACAGGGTGG - Intergenic
906640448 1:47438001-47438023 GGGGACTGAGGCAGGCAGGGAGG - Exonic
906671510 1:47658500-47658522 GAGGAATTAGCCAGGCAGAGGGG - Intergenic
908135989 1:61133233-61133255 GAGGAATGAGGAAGGAAGGGAGG + Intronic
908439423 1:64138772-64138794 GAGCAGTAAGACTGACAGGGAGG + Intronic
908464609 1:64379948-64379970 GATGAGTGAGGCTGGCAGAGCGG + Intergenic
911357838 1:96843744-96843766 GAGGGATGAGAGATGCAGGGTGG - Intergenic
912338605 1:108887624-108887646 GAGGAATGAGAATGGGAGCCTGG - Intronic
912987289 1:114446765-114446787 GAGAAAGGAGCCTGGCATGGTGG + Intronic
913177509 1:116288368-116288390 GAGAAATCTGACAGGCAGGGAGG + Intergenic
914247611 1:145897514-145897536 GAGGAGTGAGACTGGCCAGGTGG + Exonic
914921128 1:151848071-151848093 GGGGAAGGAGAGTGGCAGGCAGG + Intronic
914942463 1:152035282-152035304 CAGGAAGGAGACTGGCTGGGAGG + Intronic
915289590 1:154874284-154874306 GAGGAATGAGCCTGGAAAGGAGG - Intergenic
915334017 1:155130178-155130200 GAGGAAGGAGTCAGGCAGAGAGG - Intronic
915516325 1:156414702-156414724 GAGGAAGGAGGGTGGGAGGGTGG + Exonic
915562130 1:156693467-156693489 GAGGGAGGAGACTGGGTGGGAGG - Intergenic
915622023 1:157091883-157091905 GAGGGAAGAGACTGGCTGGTGGG + Intergenic
915656441 1:157364833-157364855 GGGGAATGAGACAGCCAGGTGGG - Intergenic
915911785 1:159919989-159920011 GAGGAAGGAGGCTGGCAAGAAGG - Intronic
916951284 1:169782908-169782930 GGGGAGTGAGACTGGAAGCGTGG - Intronic
917640655 1:176980310-176980332 GAGGTTTGAGGCTGACAGGGAGG + Intronic
917645194 1:177022950-177022972 TAGTAAAGAGACTGGAAGGGAGG + Intronic
917789468 1:178490300-178490322 GACGGATGAGACAGGCAAGGAGG - Intergenic
918759457 1:188383561-188383583 CAGAAATGATACTGGAAGGGTGG - Intergenic
920177772 1:204113816-204113838 GAGGAGTGAGGCAGGCAGTGGGG + Intronic
920196095 1:204228296-204228318 GCGGACTGAGGTTGGCAGGGAGG + Intronic
920343089 1:205287970-205287992 CAGAAATCAGGCTGGCAGGGAGG - Intergenic
920970680 1:210741400-210741422 GAGGAACAAGACTGCCACGGAGG - Intronic
921079356 1:211726250-211726272 GAGGAATGGGACTGGAACTGAGG + Intergenic
921157680 1:212450919-212450941 GAAGAATGAAACTGGGAAGGAGG - Intergenic
922722699 1:227906691-227906713 GAGGAAGGAGAGTGGGAGGGAGG - Intergenic
922722719 1:227906768-227906790 GAGGAAGGAGAGTGGGAGGGAGG - Intergenic
923101484 1:230821219-230821241 CAGGCATGAGGCTGGCAGGCAGG + Intergenic
923611358 1:235497916-235497938 GGGGATTGAGAGTGGCAGAGAGG - Intronic
923934994 1:238749497-238749519 GAGGATTCAGACTGGTATGGTGG - Intergenic
924518041 1:244782366-244782388 GAGGAATGATGGTGGCAGTGGGG - Intergenic
1062774665 10:135391-135413 GAGGGAGGAGGCCGGCAGGGAGG + Intronic
1062860682 10:806956-806978 GAAGACTGAGGCTGGCAGAGTGG + Exonic
1063865461 10:10360462-10360484 AAGGAAGGAGACAGGAAGGGAGG + Intergenic
1064043390 10:11988587-11988609 GAGGAAGGAGCATGCCAGGGAGG + Intronic
1064403479 10:15040258-15040280 CAAGCATGAGACTGGCAGGTTGG - Intronic
1065182683 10:23142746-23142768 GAGGAAGGAGAGAGGGAGGGAGG + Intergenic
1065557491 10:26931381-26931403 CAGGAAGTAGTCTGGCAGGGAGG + Intergenic
1067292883 10:44957432-44957454 GAGGAAAGAGAGAGGGAGGGAGG - Intergenic
1067338258 10:45381124-45381146 GAAGCAGGAGCCTGGCAGGGAGG + Intronic
1068512473 10:57984061-57984083 GAGGCATGAGCCTTGCAAGGGGG - Intergenic
1068883722 10:62076942-62076964 GGGAGATGAGAGTGGCAGGGTGG - Intronic
1069818170 10:71211733-71211755 CTGGAATCAGACTGGCTGGGAGG + Intergenic
1069886597 10:71627729-71627751 GGGGAAGGAGCCTGCCAGGGAGG - Intronic
1069919074 10:71805490-71805512 AATGAATGGGACTGGAAGGGCGG + Intronic
1070194801 10:74147391-74147413 GAGGAATTTGATTGGCAGGGTGG - Intronic
1070784911 10:79157294-79157316 GAGGAAGGAGCCTGGCAGGTGGG + Intronic
1070967715 10:80539684-80539706 GAGGAATGACAATGACAGGGTGG - Intronic
1071288708 10:84172739-84172761 GAGGAATCAGACTGGCAAAAGGG - Intergenic
1071344521 10:84680022-84680044 GGGGAATGGGACTGGGAGGTAGG + Intergenic
1071605167 10:86980770-86980792 TTGGAGTGAGACAGGCAGGGAGG + Intronic
1071664418 10:87540442-87540464 GAGGAGAGAGACTGACAGAGAGG - Intronic
1071926551 10:90415992-90416014 GGGGAATGAGACAGCCAGGTGGG + Intergenic
1072213096 10:93264851-93264873 GAGGCAGGAGAATGGCGGGGAGG - Intergenic
1072390147 10:94975512-94975534 GGAGAATGAGAGTGTCAGGGAGG + Intronic
1072555203 10:96509536-96509558 GAGGAATGAGACAGGGAGGAAGG - Intronic
1072574572 10:96688195-96688217 GGGGAATGACATTGGCTGGGAGG - Intronic
1072671414 10:97432559-97432581 GAGGGACAAGACGGGCAGGGAGG - Exonic
1072681987 10:97514346-97514368 GAGGGATGAGGGTGGCAGGTGGG - Intronic
1073113696 10:101078803-101078825 GAGGAATGAGAGATGCAGAGTGG - Intergenic
1073327490 10:102651086-102651108 GAGGAAGGAGGCTGGCCAGGGGG - Intronic
1073460141 10:103661373-103661395 GAGGAAAGAGAGAGGCAGAGCGG + Intronic
1073996770 10:109324569-109324591 CATGAGTGAGACTGGGAGGGCGG - Intergenic
1075783060 10:125029577-125029599 GAGGAAAGAAATTGGCAAGGTGG - Intronic
1076114924 10:127888611-127888633 GAGGAAAGAGACTAGCGGGTGGG + Intronic
1076474523 10:130743091-130743113 GAGGAAGGAGGCGGGCAGGTGGG - Intergenic
1076854316 10:133108459-133108481 GAGGAAGAGGATTGGCAGGGAGG + Intronic
1077360183 11:2137412-2137434 GAGAGAAGAGACTGGCTGGGAGG - Intronic
1078488855 11:11750742-11750764 GAGGAATGACACTGGAAGAAGGG - Intergenic
1078580986 11:12539430-12539452 GAGGGATGAGAGAGCCAGGGAGG + Intergenic
1079133538 11:17763274-17763296 GAGGAAGGTGATAGGCAGGGTGG - Intronic
1079392227 11:20032503-20032525 GAGGACCGTGGCTGGCAGGGAGG - Intronic
1080264499 11:30387458-30387480 GATAAAGGAGACTGTCAGGGAGG + Intronic
1080400525 11:31931179-31931201 GAGAGATGAAGCTGGCAGGGAGG - Intronic
1080896470 11:36452526-36452548 GAGGAATGAGTGAGGAAGGGAGG - Intronic
1081197674 11:40181181-40181203 GAGGAAGGAGGATGGGAGGGAGG - Intronic
1081576089 11:44319318-44319340 GAGGCTTGTGACTGGCAGGGAGG + Intergenic
1082115155 11:48320267-48320289 GAGAAAGGTGACTGGCAGTGGGG - Intergenic
1082258514 11:50059024-50059046 GAGAAAGGTGACTGGCAGTGGGG + Intergenic
1083089323 11:60184007-60184029 GAGGAAGGAAGCTTGCAGGGTGG - Intronic
1083199188 11:61109634-61109656 GAGGAATGAGAGGGACAGGGAGG + Intronic
1083201710 11:61124792-61124814 CAGCAATCTGACTGGCAGGGTGG - Intronic
1083270924 11:61572104-61572126 GAGGAATGAGGTTGGGGGGGGGG + Intronic
1083504149 11:63139578-63139600 GAGAAATGAGACTCTCATGGGGG + Intronic
1083787514 11:64960573-64960595 CAGGAAGCAGACTGGCAGAGTGG - Intronic
1083821657 11:65174978-65175000 GAGGGACAAGACAGGCAGGGAGG + Intergenic
1084083156 11:66842516-66842538 GGGGACAGAGGCTGGCAGGGAGG + Intronic
1084203556 11:67577843-67577865 AAGGAATGTGACTGTCAGCGGGG + Intergenic
1084680061 11:70661881-70661903 GCACAATGAGACTTGCAGGGTGG + Intronic
1084893438 11:72248766-72248788 GAAGAAGGAGACAGGCAGAGTGG + Intergenic
1085228333 11:74942875-74942897 GAGGAAGGAGACAGCAAGGGAGG + Intronic
1086761119 11:90632843-90632865 GAGCCAGGAGAATGGCAGGGTGG - Intergenic
1087243028 11:95801809-95801831 GAGAAGTGAGACAAGCAGGGAGG + Intronic
1089098501 11:115939807-115939829 GAGGACTGAAAGTGGCAGGCAGG + Intergenic
1089350699 11:117820119-117820141 GAGGAGGGAGACAGGCAGGCAGG + Exonic
1089769038 11:120789467-120789489 GAGAAATGAGACAGGTAGTGAGG - Intronic
1090492485 11:127177020-127177042 AATGCATGAGACTGGCATGGTGG - Intergenic
1090613480 11:128493148-128493170 GAAGAATGAGACTGACTAGGAGG + Intronic
1090904591 11:131064128-131064150 GAGGCAAGAGAGTGGCAGTGAGG - Intergenic
1091229271 11:133977306-133977328 GAGGGATGAGACCTGCAAGGTGG + Intergenic
1091305249 11:134532259-134532281 GAGGAATTAGGAAGGCAGGGGGG + Intergenic
1091335949 11:134765913-134765935 GAGGTAAGAGACTAGCATGGTGG + Intergenic
1091399685 12:174491-174513 GAGGGCTGAGAGTGGGAGGGAGG + Intronic
1091697936 12:2640587-2640609 GAAGAAAGAGACTGGGAGGAGGG + Intronic
1091906558 12:4194189-4194211 GAGGAGTGAGACTAGTGGGGAGG + Intergenic
1093093725 12:14949197-14949219 GAGGAGAGAGACTGGGAAGGGGG - Intronic
1094423365 12:30295469-30295491 CAGGAATGAGAAGGGCAGGCTGG - Intergenic
1095253948 12:40011644-40011666 GAGGGAGGAGACGGGGAGGGAGG - Intronic
1095693469 12:45117520-45117542 GAGGAATGAGATTGGATTGGAGG - Intergenic
1095773761 12:45990614-45990636 GAGGAGGGAGACGCGCAGGGAGG - Intronic
1096181167 12:49551164-49551186 GGGAATTGGGACTGGCAGGGAGG + Intronic
1096463268 12:51834530-51834552 GAGGAGCCAGACTGGCGGGGCGG - Intergenic
1096835715 12:54349898-54349920 GAGGCATCAGGCAGGCAGGGAGG - Intronic
1097186204 12:57197859-57197881 GAGACATGAGGCTGGCAGCGAGG - Intronic
1097191375 12:57221137-57221159 GAGGACTGAGACAGAGAGGGAGG - Intronic
1097249333 12:57623927-57623949 GAGGCATGAGCATGGCTGGGAGG + Intronic
1098436853 12:70476870-70476892 GAGTAATGAGACAGTCAGGTGGG + Intergenic
1100260229 12:92926386-92926408 GAGAAATAAGATTAGCAGGGAGG + Intronic
1100336974 12:93640765-93640787 GAGGGACAAGACGGGCAGGGAGG + Intergenic
1100878445 12:98989650-98989672 GAAGAATGAGCCAGGCACGGTGG + Intronic
1101336948 12:103805156-103805178 GAGGAATGAGACTGGAGAAGTGG + Intronic
1101356198 12:103979620-103979642 GGGGAAGGAGAGTGGCATGGGGG + Intronic
1102190048 12:110980905-110980927 GAGGAAGGAGTGAGGCAGGGAGG + Intergenic
1102652184 12:114449780-114449802 GAGAAATAAGACTTGCAGAGAGG - Intergenic
1102719488 12:115003743-115003765 AAGGAATGAGTTTGGCAGGCTGG - Intergenic
1103145836 12:118595164-118595186 GAGGAATGAGAGAGGGAGGATGG + Intergenic
1103947143 12:124532905-124532927 GAGGAGTGGGACTTGGAGGGAGG - Intronic
1104527840 12:129540775-129540797 GTTGAATGAGGCTGGCATGGTGG - Intronic
1105773122 13:23631746-23631768 GAGGAGGGAGTCTGGGAGGGAGG + Intronic
1105806693 13:23955621-23955643 GAGGAAAGAGAGTGGCAAGCAGG + Intergenic
1108597111 13:51959101-51959123 GGGGAATGAGATTGGGCGGGAGG + Intronic
1109228523 13:59726615-59726637 GAGGAGTGAGACTCTCAGGCTGG - Intronic
1109468051 13:62764554-62764576 GAGGATGAAGACTGGGAGGGAGG + Intergenic
1109745480 13:66617939-66617961 GAGGAAGGAGACAGTCAGGTGGG + Intronic
1109778567 13:67077229-67077251 GAGAAAAGAGAGTGACAGGGAGG - Intronic
1110619739 13:77581932-77581954 GAGGAAGAAGACTGGGAGGCAGG + Intronic
1111133063 13:84000602-84000624 GGGGAATGAGACAGCCAGGTGGG + Intergenic
1111945424 13:94660105-94660127 GAGGAATGTGACTGGCAACGTGG + Intergenic
1111996367 13:95169542-95169564 GAGGCAGGGGACTGGCAGTGGGG - Intronic
1112833119 13:103478088-103478110 GAGGAAGGAGAGAGGAAGGGAGG + Intergenic
1113002850 13:105662864-105662886 GAGGCTGGAGACTGGCAGGCAGG - Intergenic
1113339685 13:109409802-109409824 AGGGAATGAGCCAGGCAGGGGGG + Intergenic
1113931078 13:113969236-113969258 GAGGAATGCAACAGGCAGTGAGG + Intergenic
1113945434 13:114041330-114041352 AAGGAATGAGCCGGGCATGGTGG + Intronic
1114402634 14:22423762-22423784 GAGGAAAAGGACTGGCAGTGGGG + Intergenic
1114543791 14:23483475-23483497 GAGGAATGATGTTGGCCGGGAGG - Intronic
1114922259 14:27346800-27346822 GAGAAATGTTACTGGCAGTGTGG - Intergenic
1115298321 14:31856158-31856180 GAGGAAGGTGAATGGCAAGGAGG + Intronic
1115447314 14:33506073-33506095 GAGGATAGGGAGTGGCAGGGTGG - Intronic
1117340739 14:54789198-54789220 GAATTATGAGACTGGGAGGGGGG + Exonic
1117591657 14:57275474-57275496 GAGGAGAGAGACAGGCAGGCAGG + Intronic
1118293648 14:64549053-64549075 AAGTAGTGAGACTGGGAGGGTGG + Intergenic
1118539971 14:66813043-66813065 AAGGAATCAGACTGTCAGTGAGG - Intronic
1118914615 14:70092371-70092393 GAGGCATGACAGGGGCAGGGTGG - Intronic
1119226088 14:72945643-72945665 GAAGGATGAGAATGGCAGTGAGG - Intronic
1119491604 14:75038952-75038974 GAGGCAGGAGAATGGCATGGAGG - Intronic
1119898116 14:78238040-78238062 GAGGAATGAAATTGGAAGGAGGG + Intergenic
1120290471 14:82563659-82563681 GAGGAAGAAGAGTGGGAGGGAGG + Intergenic
1121144669 14:91573844-91573866 GAAGGAGGAGACTTGCAGGGAGG + Intergenic
1121388385 14:93551781-93551803 GGGGAATGAGACAGTAAGGGTGG - Intronic
1122076060 14:99235341-99235363 AAGGAAGGAGACAGCCAGGGAGG + Intronic
1122085203 14:99295871-99295893 CAGGTATGAGACTGGGAGTGTGG + Intergenic
1122182810 14:99968164-99968186 GAGGAATGAGACTCGCTTGCTGG + Intergenic
1122658483 14:103279033-103279055 GAGGAAGGGGCCTGGGAGGGCGG - Intergenic
1124093207 15:26625199-26625221 GTGGAGTGAGCTTGGCAGGGTGG + Intronic
1124233674 15:27968343-27968365 GGGGAATGACAGGGGCAGGGTGG + Intronic
1124371773 15:29108189-29108211 GATGAGCGAGGCTGGCAGGGTGG - Intronic
1125459978 15:39896757-39896779 GAGGAATAAGCCAGGCATGGTGG + Intronic
1125595999 15:40886451-40886473 GAGGGATGACAGTAGCAGGGAGG + Intergenic
1126479209 15:49099344-49099366 GAGGGATGTGCCTGGCAGGTTGG + Intergenic
1127635104 15:60861639-60861661 GAAGAATGAGCCAGGCATGGTGG - Intronic
1127660776 15:61098181-61098203 AAGGAAGGAGACAGGGAGGGAGG - Intronic
1127749180 15:62016153-62016175 GAGGAAGAAGAATGGTAGGGTGG - Intronic
1127916683 15:63460682-63460704 GAGAAATGAGGCAGGCAGGCAGG - Intergenic
1128110664 15:65074210-65074232 GAGGAGTGGGACAGGCAGGTTGG - Intronic
1128519569 15:68366550-68366572 GAGGAAGGAGAGGGGCAGGGTGG - Intronic
1128921497 15:71614438-71614460 GAAGATGGAGACTAGCAGGGAGG - Intronic
1129167314 15:73786064-73786086 GAGGCATCAGAGGGGCAGGGAGG + Intergenic
1129426456 15:75467036-75467058 GAGGGATGAGGGAGGCAGGGAGG - Exonic
1129436436 15:75544861-75544883 GAGGAATGTGAATGGCTGTGAGG + Intronic
1129827308 15:78642057-78642079 GAGGAACAAGACAGGAAGGGCGG + Intronic
1130954553 15:88618000-88618022 GATGAACGAGAGTGACAGGGTGG - Intergenic
1131826339 15:96324641-96324663 GAGGAATGAGATGGGCAGGGAGG + Intergenic
1132565842 16:622421-622443 GAGGAAACTGACTGTCAGGGCGG + Intronic
1132634360 16:936190-936212 GAGGAAGGAGGCTGGGAGAGAGG + Intronic
1132634442 16:936432-936454 GAGGAAGGAGGCTGGGAGGGAGG + Intronic
1132643466 16:988385-988407 GAGGGATGGGAGGGGCAGGGAGG - Intergenic
1132691405 16:1183350-1183372 GAGGAAGGAGACGGGCGTGGGGG + Intronic
1132850880 16:2024404-2024426 GAGGAATGAGGCAGCCAGAGAGG - Intergenic
1132861376 16:2073408-2073430 GAAGAATGCGACTGGGACGGGGG - Intronic
1133084071 16:3348201-3348223 GAGGAATGAGAATGGCGAGTGGG + Intergenic
1133325819 16:4941689-4941711 GAGGTAGGAGAATGGCTGGGAGG - Intronic
1133654555 16:7847877-7847899 GAGGGATGAGAGTGACTGGGAGG + Intergenic
1133812167 16:9169088-9169110 GAGAAATGAGATGGGAAGGGTGG - Intergenic
1134615887 16:15650672-15650694 GAGGATGGAGCCTGGCAGCGGGG - Intronic
1135335568 16:21598993-21599015 GAGGAGGGAGTCTGGCAGGTCGG + Intronic
1136071914 16:27792406-27792428 AAGGAGTGAGAGTGGCAGAGGGG - Intronic
1136103849 16:28014784-28014806 GACAAATGAGGCTGGCACGGTGG - Intronic
1136235866 16:28913301-28913323 TAGGATAGAGACTGGCAGTGAGG - Intronic
1136368437 16:29820757-29820779 GAGGCCTGAGAGTTGCAGGGGGG - Intronic
1137425209 16:48373606-48373628 GAACAATGAGACTGGTTGGGAGG - Intronic
1137520008 16:49184443-49184465 GAGGAATGATACAGGCAGGGTGG + Intergenic
1138339385 16:56278809-56278831 GAGGAATGAGCCTGGCGCAGAGG + Intronic
1138601848 16:58060312-58060334 AAGGAGAGAGACTGGGAGGGAGG + Intergenic
1138656025 16:58491932-58491954 GAAAAATGAGACAGGCATGGTGG - Intronic
1139965067 16:70740785-70740807 GAGGAATGAGGGAGGCAGGGTGG + Intronic
1140202546 16:72906183-72906205 GTGGAATGAGACTGGAAGGCCGG + Intronic
1140825745 16:78704341-78704363 GATGAATGAGAAGGGAAGGGAGG - Intronic
1140841025 16:78839259-78839281 GAAGAGAGAGACTGGAAGGGAGG - Intronic
1141249208 16:82339544-82339566 GGGCAATGAGACTCGAAGGGAGG - Intergenic
1141732176 16:85830028-85830050 GAGAAATGGCCCTGGCAGGGAGG - Intergenic
1141881789 16:86865117-86865139 GAGGAATGAGACTGGGCGGGGGG + Intergenic
1143331657 17:6141259-6141281 GAGGATTGGGACTTTCAGGGAGG + Intergenic
1143349523 17:6277251-6277273 GAGGAGTGAAACTGGCTGGCAGG - Intergenic
1143450812 17:7035910-7035932 GCGGAACGAGAAGGGCAGGGCGG - Intergenic
1144311159 17:14015483-14015505 GAGAAATGAGACTGTCATGCCGG - Intergenic
1144517469 17:15928571-15928593 GAGGAAATAGGCTGGCAAGGTGG + Intergenic
1145193253 17:20866528-20866550 GAGGTAGGAGCCTGGTAGGGTGG - Exonic
1145752901 17:27367913-27367935 GGGGGATGAGGCTGGCAGGAAGG - Intergenic
1146616216 17:34359213-34359235 GAGGAATTAGAATATCAGGGTGG + Intergenic
1146621856 17:34404890-34404912 TAGAAATGAGGCTGGCAGGGTGG - Intergenic
1146654649 17:34628029-34628051 GAGGAGTGTGACTGGCTGTGAGG + Intronic
1146948440 17:36889946-36889968 GAGGCCTGGGACAGGCAGGGAGG - Intergenic
1147139973 17:38455358-38455380 GAGGAAGGGGACTGGAAGGAAGG + Intronic
1147423349 17:40333430-40333452 GAGGCATGAGAATCGCTGGGAGG - Intronic
1147562901 17:41519886-41519908 GAGAAGGGAGACTGGCAGGCAGG + Exonic
1148161582 17:45453307-45453329 GTGGAGTGAGGCTGGCAGGCTGG + Intronic
1148504787 17:48118851-48118873 GAGGAATGTGCCAGGCAGGATGG + Intronic
1148806388 17:50266166-50266188 GAGGACCGAGAGTGGCAGGGAGG - Intergenic
1149334169 17:55618389-55618411 TAGGCCTGAGCCTGGCAGGGGGG - Intergenic
1149561526 17:57611181-57611203 AAGGACTGAGACTGGGAGGTGGG + Intronic
1149637344 17:58181499-58181521 GAGTCATGTGACTGGTAGGGTGG + Intergenic
1150392818 17:64799952-64799974 GCGGAGTGAGGCTGGCAGGCTGG + Intergenic
1150465193 17:65386673-65386695 GAGGAAGGAGGATGGAAGGGAGG - Intergenic
1151393083 17:73801095-73801117 GTGGGAGGAGGCTGGCAGGGTGG + Intergenic
1151699369 17:75734811-75734833 GAGGTATGAGAGAGGAAGGGAGG + Intronic
1151793518 17:76325700-76325722 GAGGCAGGAGAATGGCATGGAGG - Intronic
1151928005 17:77213015-77213037 GAGGCAGGAGCCTGGCAGGCTGG - Intronic
1151966903 17:77436308-77436330 GTGGAATGAAACATGCAGGGTGG - Intronic
1153450767 18:5225703-5225725 GAGGTATGGGCCAGGCAGGGTGG + Intergenic
1154126772 18:11698702-11698724 GACGGATGAGACTGGAATGGTGG + Intronic
1156305176 18:35872802-35872824 GGGGAAGGAGACTAGTAGGGGGG + Intergenic
1156469452 18:37368307-37368329 GAGTAGGGAGACGGGCAGGGAGG - Intronic
1156579934 18:38363066-38363088 GAGGAAGGAGTCGGGGAGGGAGG + Intergenic
1157188183 18:45558429-45558451 GAGGAATGGCACTGGTAAGGAGG + Intronic
1157281857 18:46351518-46351540 GAGGGAGGACAATGGCAGGGCGG - Intronic
1157618291 18:49000953-49000975 GACTAATGAGCCTGGCACGGTGG - Intergenic
1158151794 18:54382404-54382426 GGGGAATGAGACAGCCAGGTGGG - Intronic
1159029413 18:63215620-63215642 GAGGAATTAGAGTGGAAGGAGGG + Intronic
1160441965 18:78899890-78899912 GAGAATTGAGACTGTCTGGGTGG - Intergenic
1160710560 19:549210-549232 GGGGAATGAGGCTGGCGGGAGGG + Intronic
1160872146 19:1282410-1282432 GAGGAAGGAGAGAGGGAGGGAGG + Intergenic
1161399969 19:4062924-4062946 GAAGACTGAGGCTGGCAGAGGGG + Intronic
1161717044 19:5882126-5882148 GAATAATGAGCCTGGCAGGAGGG - Intronic
1161830957 19:6603838-6603860 CAGGAATGAGCCGGGCATGGTGG - Intronic
1162026910 19:7899563-7899585 GCGGGAGGAGACTGGCATGGGGG + Exonic
1162043809 19:7985731-7985753 CAGGAAGGAGACTGGCAGGGAGG + Intronic
1162651128 19:12089825-12089847 GAGAAATTAGCCTGGCAAGGTGG - Intergenic
1162728804 19:12705589-12705611 GATGACAGACACTGGCAGGGAGG + Exonic
1163094670 19:15048156-15048178 GAGAAAGGTGACTGGCAGGTAGG + Intergenic
1163241679 19:16067522-16067544 GCAGAGTGAGCCTGGCAGGGTGG - Exonic
1163446192 19:17347761-17347783 GAGGGATGAGGCTGGGAGAGAGG + Intergenic
1163823386 19:19509147-19509169 GAGGAATGAGAATCTCAGTGGGG + Intergenic
1164770120 19:30801893-30801915 CATCAATGAGAGTGGCAGGGAGG - Intergenic
1164878816 19:31713780-31713802 GAGGAATGATATTGTCAAGGGGG - Intergenic
1165013821 19:32866679-32866701 CAGGCCTGAGACTGGCAGAGAGG + Intronic
1165021242 19:32926029-32926051 AAGGAAGGAGTGTGGCAGGGTGG - Intronic
1165493182 19:36137116-36137138 GAGCAGTCAGTCTGGCAGGGAGG + Intergenic
1165903571 19:39179890-39179912 GGGGAATCTGACTGGCATGGAGG + Intronic
1166642941 19:44510222-44510244 ATGGAATGAGCCAGGCAGGGTGG + Intronic
1167607252 19:50488003-50488025 GAGGAAAGAGCCGGGCACGGTGG + Exonic
1167922411 19:52792696-52792718 GAGGATTGAGCCGGGCATGGTGG - Intronic
1168284097 19:55321898-55321920 GAGGAAGGAGAGTGGAGGGGAGG - Intronic
1168430737 19:56277751-56277773 AAGGAAGGAGGGTGGCAGGGAGG + Intronic
1168719826 19:58548828-58548850 GAGAAAGAAGACTGGCAGGTTGG - Intronic
1168723206 19:58566157-58566179 GAGGAATGGGCCAGGCATGGTGG + Intronic
925203141 2:1985115-1985137 GAGGAGTGACTGTGGCAGGGAGG - Intronic
925290924 2:2748261-2748283 GAGGACTGGCACTGCCAGGGTGG - Intergenic
925370608 2:3342560-3342582 GAGGCAGGAGACTGGGAGAGAGG - Intronic
925873841 2:8294611-8294633 GAAGAATGGGACTGGTAGGAAGG - Intergenic
926148018 2:10408614-10408636 AAGGAATGAGGCTGGTGGGGAGG - Intronic
926577250 2:14595748-14595770 GGGGACTGTGACTGGCTGGGAGG + Intergenic
927138847 2:20116011-20116033 GAGGGCTGAGGCTGTCAGGGTGG + Intergenic
928219493 2:29391663-29391685 GAGGAGGGAGACAGGGAGGGAGG - Intronic
928264477 2:29800131-29800153 GAGGAATGTGAAAGCCAGGGAGG + Intronic
928592378 2:32830834-32830856 GAGGATAGAGACTGGGAGGAGGG + Intergenic
928939031 2:36708604-36708626 GAGGAATCAGACTGTCAGAGAGG - Intronic
929021194 2:37554968-37554990 GAGGAAAGAGACTTGCAGGAAGG + Intergenic
929400314 2:41572592-41572614 AAGAAATGAGCCTGGAAGGGAGG - Intergenic
929529435 2:42738174-42738196 GTGGATTGAGACTGGGAGGTCGG + Intronic
929936830 2:46299094-46299116 GAGGGAGGTGACTGGCCGGGAGG + Intronic
930241340 2:48938510-48938532 GAGGAAGGAGAGAGGGAGGGAGG - Intergenic
930246594 2:48989973-48989995 GAGGAAGGAGATAAGCAGGGAGG - Intronic
931147880 2:59539831-59539853 GAGGAATGGGATTGGAATGGTGG - Intergenic
931196394 2:60055918-60055940 GAGAAATGAGACAGGCAGTCTGG + Intergenic
931304144 2:61012410-61012432 GAAGAATGAGACAGACAGGAGGG - Intronic
932020107 2:68075757-68075779 GAGGACTGAGAGTGCCATGGTGG - Intronic
932722542 2:74148179-74148201 GAGGAATGAGACTTTCACGCGGG - Intergenic
933013913 2:77100115-77100137 GTGGAATGAGGCTGACAAGGAGG - Intronic
934041418 2:88130333-88130355 GAGGAATGTGGCAGGCAGGCAGG + Intergenic
935358443 2:102226632-102226654 AAGGAAGGAGACAGGGAGGGAGG + Intronic
935977248 2:108590997-108591019 GAAGGATAAGAATGGCAGGGAGG + Intronic
936143349 2:109960410-109960432 GAGAAACTAGACTGGCATGGTGG + Intergenic
936180037 2:110258376-110258398 GAGAAACTAGACTGGCATGGTGG + Intergenic
936201338 2:110411056-110411078 GAGAAACTAGACTGGCATGGTGG - Intronic
936234621 2:110732516-110732538 GAGGGAGGAGACGGGCCGGGAGG + Intergenic
936659282 2:114524240-114524262 GAGGAAACAGAATGTCAGGGAGG + Intronic
936885686 2:117308317-117308339 CAGGAGTGTGACTGGGAGGGAGG - Intergenic
937278879 2:120703932-120703954 GAGGTTTGAGAATGGCAGGAGGG + Intergenic
938066759 2:128285669-128285691 CAGGAGTCAGCCTGGCAGGGTGG - Intronic
938700644 2:133876082-133876104 GAGAGATGAGACTTGCATGGGGG - Intergenic
938919883 2:135985542-135985564 GAGGGCGGAGACTGGGAGGGAGG - Exonic
938949806 2:136245623-136245645 GAGGAATGAGAACGCCAGGGAGG + Intergenic
938968950 2:136414880-136414902 GTGGCAAGAGACAGGCAGGGTGG + Intergenic
939192034 2:138928258-138928280 GAGGAATTAAACTGGCAGCTTGG - Intergenic
940143067 2:150516450-150516472 GAGGCAGGAAAATGGCAGGGAGG - Intronic
942226821 2:173823776-173823798 GATGCATGAGGCTGGCAGGAGGG - Intergenic
943018448 2:182543956-182543978 GTGGAGGGAGACTGGCAGGTGGG - Intergenic
944695682 2:202198360-202198382 AAGAAATGAGACTGGCATGTTGG + Intergenic
945255084 2:207796734-207796756 CAGGAATGAGACTGCCAGGAGGG + Intergenic
945913067 2:215671424-215671446 GAGGAATGAGAGCGGAAGGTTGG + Intergenic
945969477 2:216221802-216221824 GTGGAGTGAGACTGGCAGAAAGG + Intergenic
946188918 2:217996923-217996945 GGGGATTGGGACTGGCAGGGTGG - Intronic
946226166 2:218265182-218265204 GAGGAATGACAGAGGCAGGGCGG + Intronic
946234713 2:218316856-218316878 GAGGTAGGAGACTGTCAGGTTGG + Intronic
946284620 2:218693691-218693713 AAGGAAGGAGTCTGGCAGTGAGG - Intronic
947231411 2:227891561-227891583 CAGGAATGAGTCGGGCAGGGTGG + Intronic
948458386 2:238117814-238117836 GAGGAATGAATGGGGCAGGGAGG + Intronic
948679884 2:239626620-239626642 GAGTCAGGGGACTGGCAGGGGGG - Intergenic
948720069 2:239893916-239893938 GAGGAATGAGATTGGGATGATGG - Intronic
948720100 2:239894045-239894067 GAGGAATGAGATTGGGATGATGG - Intronic
948720148 2:239894256-239894278 GAGGAATGAGATTGGGATGATGG - Intronic
948855261 2:240727356-240727378 GAGGAAGGACAGAGGCAGGGAGG + Intronic
949042675 2:241856669-241856691 AAGAAATTAGCCTGGCAGGGTGG + Intronic
949081406 2:242103369-242103391 GGGGAATGAGACTGCCACAGTGG + Intergenic
1169251852 20:4067137-4067159 GTGGGATGAGGCTGGTAGGGAGG + Intergenic
1170326028 20:15155334-15155356 GAGAAATGAGGCTGGAAGGGAGG - Intronic
1171191140 20:23160658-23160680 GAGGACGAAGACAGGCAGGGTGG - Intergenic
1171369812 20:24654627-24654649 GAGGAAGGAGAGAGGGAGGGAGG + Intronic
1172134734 20:32679317-32679339 GAGGGAAGAAACTGGCAGGCTGG + Intergenic
1172617121 20:36296553-36296575 AAGGAAAGAGACAGGCATGGTGG - Intergenic
1172897619 20:38311637-38311659 AAGGAATGAGACTGGGACGGGGG + Intronic
1175229679 20:57465813-57465835 GAGGAATGAGAGGATCAGGGTGG - Intergenic
1175247789 20:57591989-57592011 GAGCAATGAGAAGGGCAAGGAGG + Intergenic
1175371723 20:58496861-58496883 GAGGCCTGAGCCTGGCATGGAGG + Intronic
1175385634 20:58593184-58593206 GAGGAAGAAGGCTGGAAGGGTGG - Intergenic
1175524817 20:59626368-59626390 GAGGAATGAGACTGGCAGGGAGG + Intronic
1175818909 20:61897977-61897999 GACGGATGACCCTGGCAGGGAGG + Intronic
1176046616 20:63096290-63096312 GAGGGATGAGACTCTCAAGGAGG + Intergenic
1176409001 21:6437602-6437624 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1178049523 21:28732625-28732647 CATGAAAGGGACTGGCAGGGGGG + Intergenic
1178241725 21:30910662-30910684 GAGAAGTGAGACTGGCATTGAGG - Intergenic
1178713913 21:34946154-34946176 GTGGAAAGAGACTGGCATGAGGG - Intronic
1179684494 21:43045924-43045946 GGGGGAGGACACTGGCAGGGAGG - Intergenic
1179877788 21:44279965-44279987 GAGGGAGGAGACAGGCAGGGTGG + Intergenic
1180107374 21:45629048-45629070 GAGGAAGGTGACTCTCAGGGAGG + Intergenic
1180608488 22:17079950-17079972 GAGGCTTGAGCCTGGGAGGGAGG - Intergenic
1181510098 22:23385219-23385241 GAAGAATGAGGCAAGCAGGGTGG + Intergenic
1181828474 22:25539341-25539363 GAAGAAGGAGATTGGCCGGGAGG - Intergenic
1182693336 22:32178625-32178647 GAGGATTGAGACTGGCAGCGTGG + Intergenic
1182693490 22:32179856-32179878 TAGGATTCAGACTGGCAGGGTGG + Intergenic
1182741719 22:32572503-32572525 GAGGAAAGAGAAAGGGAGGGAGG - Intronic
1183167447 22:36158530-36158552 AAGGAATGCGCCTGGCACGGTGG + Intronic
1183193048 22:36334175-36334197 TAGAAATGAGACTGACAGGCAGG + Intronic
1184108621 22:42382814-42382836 GAGCAAGGAGAGAGGCAGGGAGG - Exonic
1184391800 22:44207293-44207315 GAGGGGTGAGGCTGGCGGGGAGG + Exonic
1184391808 22:44207312-44207334 GAGGGGTGAGGCTGGCGGGGAGG + Exonic
1184775224 22:46619789-46619811 GAGGACTGAGACTTGGAGGAGGG + Intronic
1184831421 22:46991179-46991201 GAGAAATGAACCTGGCAGGTAGG + Intronic
1184846254 22:47089576-47089598 GAGGAGTGAGGCCGGCAGGGTGG + Intronic
1185118086 22:48949326-48949348 GAGGAGTGAGGCTGGAAGAGAGG - Intergenic
1185318033 22:50187139-50187161 GAGGAGGGGGCCTGGCAGGGTGG + Intronic
949374388 3:3371843-3371865 GGGGACTGAGACAAGCAGGGTGG - Intergenic
949468630 3:4370104-4370126 GAGGACTGAGAGTGACTGGGTGG + Intronic
950138828 3:10601392-10601414 GAGGAATAACACGGGGAGGGAGG + Intronic
950280712 3:11705396-11705418 GAAGACTAAGAGTGGCAGGGAGG + Intronic
950420603 3:12896551-12896573 TATGAATGAGACTGGAAGAGGGG + Intergenic
950911950 3:16604754-16604776 CAGAAATGAGGCTGGCGGGGCGG + Exonic
951097288 3:18646643-18646665 GAGGAATGCCACTGGCAGGAAGG - Intergenic
951346068 3:21547930-21547952 GAGGAATGAGACAGCCAGGTGGG + Intronic
951566193 3:24014691-24014713 GAAGAATGAGACTGGGAAGTAGG - Intergenic
951703878 3:25524621-25524643 GAGGAAGGAGGGAGGCAGGGAGG - Intronic
952327701 3:32335835-32335857 AAGCAAGGAGACTTGCAGGGCGG + Intronic
952794298 3:37225158-37225180 GAGGAAACAGGCTGGCAGGCTGG + Intergenic
954453587 3:50585098-50585120 GAGGAATGGGACTGGGATGTGGG + Intergenic
954672750 3:52299384-52299406 CATGAAGGGGACTGGCAGGGAGG + Intergenic
955240598 3:57174699-57174721 GAGGAAGCAGCCTGGCAGGGAGG - Intergenic
955335966 3:58086409-58086431 CAGGAATGAGATTGGCAGTTGGG - Intronic
955572789 3:60326141-60326163 GTGGAGTGGGGCTGGCAGGGGGG + Intronic
955613383 3:60780746-60780768 GAGGAATGAGACAGCTAGGTGGG + Intronic
955901847 3:63764360-63764382 GAGGAAGGAGAGAGACAGGGAGG + Intergenic
955959679 3:64327449-64327471 GGGGAATGGAACAGGCAGGGAGG + Intronic
956098710 3:65745263-65745285 GAGGAATGAGACAGGCAAAGGGG + Intronic
956371891 3:68571672-68571694 GAGTATTGTGACTGGCAGGCTGG + Intergenic
956648252 3:71478509-71478531 GAAGAATGAGAGTGGCAAGGAGG + Intronic
956710987 3:72038750-72038772 GAGGAATGATTCTGTCAAGGAGG - Intergenic
957286733 3:78225975-78225997 AATAAATGAGACTGGCAAGGTGG - Intergenic
957302101 3:78405428-78405450 GAGGAATGGCACTGGTAGAGTGG - Intergenic
959078958 3:101779771-101779793 GAGATATGAGATGGGCAGGGAGG - Intronic
959346465 3:105201218-105201240 GTAGAAAGAGAGTGGCAGGGTGG + Intergenic
960290377 3:115877282-115877304 GAGGCATGAGGGTGGGAGGGAGG - Intronic
960590120 3:119357447-119357469 CGGTGATGAGACTGGCAGGGGGG + Intronic
960900089 3:122545585-122545607 TAGGAATGGGACTGACAGAGTGG - Intronic
961521837 3:127471559-127471581 GAGGAAAGAGACAGGCAGGGAGG + Intergenic
963263924 3:143220498-143220520 GAGGTATGAGACTGCCATGCAGG + Intergenic
965028175 3:163328976-163328998 GGGGAATGAGACAGCCAGGTGGG + Intergenic
966523836 3:180900156-180900178 GGGGAATGAGACAGCCAGGTGGG + Intronic
966525537 3:180914932-180914954 GAAGAATGAGAATGGCGGAGTGG + Intronic
967039091 3:185672923-185672945 CAGGAGTGAGGCTGGCAAGGTGG - Intronic
967846766 3:194049910-194049932 GAAGAATGAGACTGGCACTCAGG - Intergenic
967937021 3:194737158-194737180 GAGGGAAGAGAAAGGCAGGGTGG - Intergenic
968208055 3:196822349-196822371 GAGTACTGAGACTGGCAGGAAGG + Intronic
968773741 4:2526027-2526049 GAGGCAGGAGAATGGCATGGAGG + Intronic
969313625 4:6368692-6368714 GAGGAATGAGATTGTAAGGATGG - Intronic
969334534 4:6499886-6499908 GAGGAAGGAGAGTGGCTTGGTGG - Intronic
969881743 4:10180045-10180067 GTTTAATGAGACTGGCAGAGAGG - Intergenic
970690048 4:18611818-18611840 AAGGAAGGAGAAAGGCAGGGAGG + Intergenic
970690282 4:18612480-18612502 AAGGAAGGAGAAAGGCAGGGAGG + Intergenic
970690332 4:18612617-18612639 AAGGAAGGAGAAAGGCAGGGAGG + Intergenic
970690340 4:18612652-18612674 GAGGAAGGAGAAAGGCAGAGAGG + Intergenic
970916096 4:21337038-21337060 GAGGAAAGAGCATGGCAGGTGGG + Intronic
971045705 4:22802824-22802846 GAGGTATGGGCCTGGCACGGTGG - Intergenic
971954837 4:33403449-33403471 AAGGAAGGAGAGAGGCAGGGAGG - Intergenic
972653063 4:41038470-41038492 GAGGAATTAGACTGGCTGTCAGG - Intronic
973022966 4:45226333-45226355 GATGAATGAGCCAGGCATGGTGG + Intergenic
973685008 4:53360673-53360695 GAGGTAGGTGTCTGGCAGGGAGG - Intronic
974420290 4:61663608-61663630 GAGGAATGAGCCCAGCAGGCCGG + Intronic
974975652 4:68887988-68888010 GAGGAATGACACTGTCATTGAGG + Intergenic
975668564 4:76757078-76757100 GAGGAATGGCTCTGGCAGTGAGG + Intronic
975808306 4:78136852-78136874 GAGGAATTAAACTGATAGGGTGG - Intronic
976116414 4:81733084-81733106 GGGAAATTTGACTGGCAGGGAGG + Intronic
976345407 4:83994051-83994073 GGGGAATGAGACAGCCAGGTGGG + Intergenic
977770207 4:100849076-100849098 TAGGAATGAGACTGCAAGTGAGG - Intronic
979272856 4:118782820-118782842 GAGGCAGCAGCCTGGCAGGGGGG - Intronic
979505527 4:121491415-121491437 GAGGAATGAGGAAGGAAGGGAGG - Intergenic
980186086 4:129462869-129462891 GAGGAGTGAAACAGGAAGGGAGG + Intergenic
981259785 4:142706032-142706054 GAGGGATGAGGCTGGGAGTGTGG - Intronic
982321176 4:154078736-154078758 GAGAAAGGTGATTGGCAGGGGGG + Intergenic
983252170 4:165357722-165357744 GAAGAAGGAGAGAGGCAGGGAGG - Intergenic
983691045 4:170469582-170469604 GAGGAAGGAGAGAGGGAGGGAGG - Intergenic
984855002 4:184187427-184187449 GAGCAATGAGAGTGGCAGTGAGG - Intronic
984939811 4:184921196-184921218 GAAGAATGAGCCAGGCATGGTGG - Intergenic
985222854 4:187726280-187726302 AAGGAAGGAGACTGGAAAGGAGG - Intergenic
986213839 5:5699361-5699383 GGGGAATGAGACAGCCAGGCGGG + Intergenic
987288108 5:16480120-16480142 GAGGCAGGAGACTGGAAGGAAGG - Intronic
988519329 5:31931682-31931704 GAGGAATGAGACTGAAAAGGGGG + Intronic
988859977 5:35267562-35267584 TAGGAATGAGACAGGCAGAAAGG + Intergenic
989122522 5:38018745-38018767 GAGGAATTGGACAGGCAGGCAGG - Intergenic
990443754 5:55872767-55872789 GAGCAATGACATTGGCAGGGTGG - Intronic
990453936 5:55965701-55965723 GATGAATGAGCCGGGCGGGGTGG + Intronic
991014432 5:61915890-61915912 GGGGAATGAGACAGCCAGGTAGG + Intergenic
991362886 5:65839540-65839562 GAGGATGGAGGCTGGCAGGAGGG + Intronic
992676790 5:79112831-79112853 GTGGAATGAGACTGGACAGGTGG + Intronic
992678953 5:79134074-79134096 GAGGGAGGAGAGAGGCAGGGAGG + Intronic
994274250 5:97815935-97815957 TAAGAATGAGATTGGCAGGGAGG - Intergenic
995405647 5:111792248-111792270 GTAGAATGAGACTGACAGTGTGG - Intronic
995433346 5:112107097-112107119 GAAGAGTGAGACTGGGAAGGAGG - Intergenic
996510886 5:124314798-124314820 GAAGAATTAGCCTGGCATGGTGG + Intergenic
996575484 5:124972993-124973015 GGGGAATGAGACAGCCAGGTGGG + Intergenic
997442354 5:133917760-133917782 CATTAATGAGACTTGCAGGGGGG + Intergenic
997495311 5:134318770-134318792 GAGAAATGGGCCAGGCAGGGTGG - Intronic
998152049 5:139763139-139763161 GAGGAATAACCCTGGCAGGAGGG + Intergenic
998550680 5:143075006-143075028 GAGGACTGTGACTGCCTGGGAGG + Intronic
999008304 5:148006322-148006344 GGGGAATGAGACAGCCAGGTGGG + Intergenic
999068434 5:148716682-148716704 TAGCAAAGAGACTGGCAGGTGGG + Intergenic
999120030 5:149202041-149202063 GAGGGATGATATTGGCATGGAGG + Intronic
999292695 5:150437101-150437123 AAGGAAAGAGGCAGGCAGGGAGG + Intergenic
999624665 5:153507479-153507501 GAGCAATGAGTTTGGCAGGAAGG - Intronic
999881021 5:155864001-155864023 GAGGAATGGGAGTGGGAGGCTGG + Intergenic
1000413052 5:160954286-160954308 GAGGAATGAGCTGGGCACGGTGG + Intergenic
1000558144 5:162752756-162752778 GAGAAATGAGGCTAACAGGGAGG - Intergenic
1001445535 5:171779820-171779842 GAGGAAGGAGAGAGGGAGGGAGG + Intergenic
1001479942 5:172081765-172081787 GAGGAAGGAGACAAGCAGGCTGG - Intronic
1001482544 5:172098463-172098485 GAGCCATGAGACGGGCAGGATGG + Intronic
1002457315 5:179352886-179352908 GAGGAAGGAGCCGGGCACGGTGG + Intergenic
1002491109 5:179578044-179578066 GAGGAATGAGATTGACATGGAGG - Intronic
1002912621 6:1501916-1501938 GGGGAATGAGACTGGAAGCCAGG + Intergenic
1003135765 6:3433768-3433790 CAGGGATGAGACTGACACGGCGG + Intronic
1003159662 6:3624383-3624405 GAGGACTGTGGCTGGCTGGGTGG + Intergenic
1003646007 6:7913247-7913269 GAGGATGGCGACTGACAGGGTGG - Intronic
1003965200 6:11246336-11246358 GTGGACTGAGCCTGTCAGGGAGG - Intronic
1004295568 6:14406842-14406864 GAGGAGTGAGAGAGGGAGGGAGG + Intergenic
1005900468 6:30213133-30213155 GAGGGATCTGGCTGGCAGGGAGG + Intronic
1006012457 6:31054232-31054254 GTGGAAGGAGAAGGGCAGGGTGG + Intergenic
1006079011 6:31553496-31553518 GAGGAATGAAACTTGGAAGGCGG + Intronic
1006150123 6:31982612-31982634 GTGGAAGGAGAATGCCAGGGTGG - Intronic
1006156424 6:32015350-32015372 GTGGAAGGAGAATGCCAGGGTGG - Intronic
1006410338 6:33870065-33870087 GAGGAAGGAGAGGGGTAGGGAGG + Intergenic
1006682212 6:35805371-35805393 GAAGAGGGAGACGGGCAGGGCGG + Exonic
1006913039 6:37576516-37576538 GATGAATAAGACTGGGAGGAAGG - Intergenic
1007242413 6:40436594-40436616 GAGAACAGGGACTGGCAGGGTGG - Intronic
1007301781 6:40873177-40873199 GAGGAAGGAGGCTGGGAGGAAGG - Intergenic
1007960413 6:45953806-45953828 GAACAATGAGACTCTCAGGGTGG + Intronic
1008402252 6:51077796-51077818 GAGTACTGAGACTGGTAGTGGGG + Intergenic
1008724457 6:54400121-54400143 AAGGAATGCCAGTGGCAGGGAGG + Intergenic
1009057356 6:58353013-58353035 GAGGATTGGGAATGGAAGGGAGG + Intergenic
1009233871 6:61098557-61098579 GAGGATTGGGAATGGAAGGGAGG - Intergenic
1009907801 6:69890846-69890868 GAGGAATGAGTCAGCCAGGTGGG - Intronic
1011626343 6:89286705-89286727 AAGGAATGAGACTGCCACGAGGG + Intronic
1014835360 6:126155220-126155242 CGGGAGTAAGACTGGCAGGGAGG + Intergenic
1016335899 6:143004800-143004822 GAGGAATGAGGGTGGCAGAGGGG + Intergenic
1017045454 6:150343453-150343475 GAGGGATGAGACTCCCATGGGGG - Intergenic
1018446250 6:163861802-163861824 TTGGAATGAGACTGGAAGTGTGG - Intergenic
1019618584 7:1978456-1978478 GGGGAAGGAGAGTGGCAGAGGGG - Intronic
1020677316 7:11197491-11197513 GGGGAATGAGACAGCCAGGTGGG + Intergenic
1021068470 7:16207190-16207212 CAGGAATGAGAGTGGAAGAGTGG - Intronic
1021516425 7:21492910-21492932 TAAGAATCAGACTGGCATGGTGG + Intronic
1021938367 7:25653873-25653895 GAAGAGTGAAACTGGCTGGGAGG + Intergenic
1021963379 7:25894435-25894457 GTGGAATGTGAGTGGCAGTGAGG + Intergenic
1021970639 7:25962511-25962533 GAGGACTGGGACTGGGAGGAAGG - Intergenic
1022421064 7:30223857-30223879 GTAGAATGAGAAAGGCAGGGAGG + Intergenic
1023025935 7:36049586-36049608 GAGGAAACAAACTGGAAGGGTGG + Intergenic
1023056478 7:36294408-36294430 TAGAAATGATACTGGCAGAGGGG + Intronic
1023090821 7:36615904-36615926 GAGTGATGAGACTGTCTGGGAGG - Intronic
1023718747 7:43071769-43071791 GGGGAATGAGACAGCCAGGTGGG - Intergenic
1023871643 7:44266545-44266567 CCAGAATGAGGCTGGCAGGGAGG - Intronic
1023963234 7:44945188-44945210 GAGGAATGGGGGTGGGAGGGAGG + Intergenic
1024277813 7:47693109-47693131 GAAGAATGAGAATAGCTGGGAGG - Intergenic
1026432657 7:70362619-70362641 GAGGAAGGAGAGAGGGAGGGAGG - Intronic
1026781078 7:73267892-73267914 GACAAATGAGAGGGGCAGGGTGG - Intergenic
1027021932 7:74821334-74821356 GACAAATGAGAGGGGCAGGGTGG - Intronic
1027066089 7:75124583-75124605 GACAAATGAGAGGGGCAGGGTGG + Intronic
1028153654 7:87405340-87405362 GAGGAATGAGGGTGGGAGGAAGG + Intronic
1029204392 7:98860244-98860266 GAGGAAGGAGACTTTCAGGACGG + Exonic
1029995488 7:105003919-105003941 GAGAGATGAGACTGGAAAGGGGG - Intergenic
1030327812 7:108239731-108239753 GAAGAAGGAGAATGACAGGGAGG + Intronic
1030785407 7:113654310-113654332 GAGGAATGGGACTGGGAAGGAGG + Intergenic
1031809719 7:126351381-126351403 GAAGCAGGAGAATGGCAGGGAGG - Intergenic
1032304442 7:130719458-130719480 GAGGAATGAGAACAGCAAGGTGG - Intergenic
1032312953 7:130805550-130805572 GAAGAATGAGACTAACTGGGAGG - Intergenic
1032885702 7:136135953-136135975 GAGGCAGGAGAATGGCAGGCAGG + Intergenic
1033081528 7:138303343-138303365 GAGGACAGAAACTGGGAGGGAGG + Intergenic
1033362371 7:140646844-140646866 ATGGAATGAGAGAGGCAGGGGGG - Intronic
1033399069 7:141004840-141004862 GAGGCAGGAGAATGGCAGGGAGG - Intergenic
1033586853 7:142780561-142780583 GAGGCATGAGACTGGGAGTGGGG - Intergenic
1034356095 7:150451577-150451599 GAGGGCTGAGACTGGCAGAAGGG + Intronic
1034596112 7:152193740-152193762 TGGGAATGGGACTTGCAGGGAGG + Intronic
1034964131 7:155381390-155381412 GAGCAATGATACTGGGAGAGGGG - Intergenic
1035225971 7:157432390-157432412 GGAGAATGAGACAGGCAGGCCGG - Intergenic
1035539317 8:420167-420189 GGGGAATGAGACTGCCACAGTGG + Intronic
1036285654 8:7442478-7442500 GAGGAATGAAAGTGGGAGGAAGG - Intergenic
1036335819 8:7869051-7869073 GAGGAATGAAACTGGGAGGAAGG + Intergenic
1036580657 8:10072069-10072091 GAGCAATGAGGTTGGCAGGTTGG + Intronic
1036673980 8:10813867-10813889 GAGGAAGGAAACTGGGAAGGTGG + Intronic
1037111593 8:15169258-15169280 GGGAAATGAGACAGCCAGGGAGG + Intronic
1038808033 8:30812553-30812575 GAGGACTGAGCCGGGTAGGGCGG + Exonic
1038953628 8:32444078-32444100 GAGGAAAGAGAGAGGGAGGGAGG - Intronic
1039055538 8:33533396-33533418 AAAGAATGAGCCGGGCAGGGCGG - Intergenic
1039733015 8:40300127-40300149 GAGGGAGGGGACTGCCAGGGTGG - Intergenic
1041426059 8:57721915-57721937 GAGGAAAGAGCCTGGAAGGCAGG - Intergenic
1041721199 8:60976990-60977012 GAGGAGTGAAACTAGCAGGTAGG - Intergenic
1043398915 8:79864822-79864844 GAGTAATGGAGCTGGCAGGGTGG - Intergenic
1043676651 8:82964679-82964701 TAGGACTGAGCCTGGCACGGTGG - Intergenic
1043803652 8:84643579-84643601 CAGAAATTAGACTGGCAGGCTGG + Intronic
1044553268 8:93535426-93535448 GAGGGATGAGCCTGGAAAGGTGG - Intergenic
1044790104 8:95838461-95838483 GTCAAATGAGACTGGCATGGAGG - Intergenic
1045055081 8:98361955-98361977 GAGGATTCAGGCTGGCAGTGAGG - Intergenic
1045748856 8:105457811-105457833 CAGGTATGAGAGTGACAGGGAGG - Intronic
1046068549 8:109223473-109223495 GGGGAATGAGACAGCCAGGTGGG + Intergenic
1046319011 8:112546168-112546190 GAGGAGTGAAGCTGGCAGGTAGG + Intronic
1046320514 8:112568303-112568325 AAGGAATGGGGCTGGCATGGTGG + Intronic
1046914737 8:119667877-119667899 GAGAAATGAGACTGGAGTGGTGG - Intronic
1047194411 8:122708380-122708402 GAGGAATGAGACTGGAGGCAGGG + Intergenic
1047384533 8:124396704-124396726 GAAAAATTAGACTGGCATGGTGG - Intergenic
1047701668 8:127455248-127455270 GAGGCAAGACACTGGGAGGGTGG + Intergenic
1048378098 8:133840007-133840029 GTGGAATGAAACTTGCATGGTGG - Intergenic
1048860537 8:138721744-138721766 CAGGAATTAGCCTGGCATGGGGG - Intronic
1049356785 8:142193013-142193035 GATGAAGGAGAGTGGGAGGGAGG + Intergenic
1049370306 8:142261184-142261206 GAGGAAGGAGAGAGGAAGGGAGG + Intronic
1049683312 8:143929378-143929400 GAGGGATGGGACTGGATGGGGGG + Intronic
1051065266 9:13094593-13094615 GAGGAATGAGCCAGGAGGGGAGG + Intergenic
1053181019 9:35970179-35970201 GAACAATGAAACTGGCTGGGTGG - Intergenic
1053240134 9:36488043-36488065 GAGGAGGGAGTCTGGCAGGCGGG - Intergenic
1056497463 9:87173289-87173311 GATGAAGGAGACAGGCAGGAGGG + Intergenic
1056558295 9:87707524-87707546 ACGGAATGAGACGGGGAGGGAGG - Exonic
1057832013 9:98414426-98414448 AAGGAATGTGACCGGCAAGGTGG + Intronic
1057859693 9:98630347-98630369 GAGAGATGAGGTTGGCAGGGAGG + Intronic
1057870295 9:98711595-98711617 GAGGATTGAGACTGGCAGAGTGG + Intergenic
1057870456 9:98712817-98712839 TAGGATTGAGACTGGAAGGGTGG + Intergenic
1058475311 9:105327176-105327198 GAGAAAAGAGACTGGCCAGGAGG - Intronic
1058599571 9:106654487-106654509 GAGGCATGACACTAGAAGGGAGG - Intergenic
1061147500 9:128808515-128808537 GTGGAAGGAGACAGGCAGAGAGG - Exonic
1061162335 9:128902566-128902588 CTGGAATGAGACAGCCAGGGCGG - Intronic
1062080817 9:134622504-134622526 GAGGAAAGAGACAGGGATGGAGG - Intergenic
1062144058 9:134979101-134979123 GAGGAAGGAGAGAGGGAGGGAGG + Intergenic
1062343125 9:136102525-136102547 GAGGAATGAGGAGGGCTGGGAGG + Intergenic
1185485910 X:481739-481761 GAGGAAGGAGACAGGGAGGAAGG + Intergenic
1185824897 X:3240632-3240654 GAGGAAGGAGAGTGAGAGGGAGG - Intergenic
1186291867 X:8109088-8109110 GAGGAAGGAGGGAGGCAGGGAGG - Intergenic
1186452552 X:9685552-9685574 GAAGAATGTGACTGCCAGGTGGG - Intronic
1186506677 X:10099159-10099181 GAGGATGAAGACTGGAAGGGAGG - Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186530773 X:10293080-10293102 GAGAAATGAGACATGCAGTGTGG + Intergenic
1187048854 X:15675961-15675983 GAGGAATGGGAGTGGGAGGCTGG + Intergenic
1187164029 X:16787670-16787692 GGGGACTGAGACTGGGAAGGTGG + Intronic
1187477934 X:19628355-19628377 GAGGATTTACTCTGGCAGGGAGG - Intronic
1189339219 X:40191958-40191980 GAGGAATGAGTCTGGGAGCCGGG + Intergenic
1192505458 X:71679153-71679175 GAGGAATGCAATTGGGAGGGTGG - Intergenic
1192543857 X:71996771-71996793 GAGCAATGAGACAGGCAGAAAGG + Intergenic
1192550879 X:72052628-72052650 GAGGAATGAGAGGGACATGGGGG - Intergenic
1194402633 X:93457856-93457878 GAGGAATGAGGCAGCCAGGTAGG - Intergenic
1195532826 X:105976605-105976627 GAGGAAGGAGAGTGGGAGGAGGG - Intergenic
1197062398 X:122196454-122196476 GGGGAATGAGACAGCCAGGTGGG + Intergenic
1197705818 X:129633827-129633849 GAGGGATGAGACTGAATGGGTGG + Intergenic
1198220447 X:134595810-134595832 GAAGACAGAGACTGGCAGAGTGG - Intronic
1198444847 X:136702437-136702459 AAAGAATGAGACTGTCAGAGTGG + Intronic
1199255701 X:145716330-145716352 GGGGAATGAGACAGCCAGGTGGG + Intergenic
1199488022 X:148369605-148369627 GAGGAATGAAATAGGCAGGCTGG - Intergenic
1199976693 X:152898471-152898493 GAGGGATCAGGCTGGCAAGGGGG - Intergenic
1201145168 Y:11060588-11060610 GAGGAATAAGACAGGAAGGCTGG + Intergenic