ID: 1175525880

View in Genome Browser
Species Human (GRCh38)
Location 20:59632997-59633019
Sequence GTGCACCCCAGGATCAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175525880_1175525895 14 Left 1175525880 20:59632997-59633019 CCCACCTTGATCCTGGGGTGCAC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1175525895 20:59633034-59633056 GAGGAGTGTGGGAGTTGATGGGG 0: 1
1: 0
2: 1
3: 38
4: 493
1175525880_1175525889 -10 Left 1175525880 20:59632997-59633019 CCCACCTTGATCCTGGGGTGCAC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1175525889 20:59633010-59633032 TGGGGTGCACGGGGGCAGGAAGG 0: 1
1: 0
2: 1
3: 44
4: 557
1175525880_1175525896 24 Left 1175525880 20:59632997-59633019 CCCACCTTGATCCTGGGGTGCAC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1175525896 20:59633044-59633066 GGAGTTGATGGGGAGATGAGAGG 0: 1
1: 1
2: 5
3: 75
4: 571
1175525880_1175525894 13 Left 1175525880 20:59632997-59633019 CCCACCTTGATCCTGGGGTGCAC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1175525894 20:59633033-59633055 AGAGGAGTGTGGGAGTTGATGGG 0: 1
1: 0
2: 2
3: 19
4: 301
1175525880_1175525890 -5 Left 1175525880 20:59632997-59633019 CCCACCTTGATCCTGGGGTGCAC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1175525890 20:59633015-59633037 TGCACGGGGGCAGGAAGGAGAGG 0: 1
1: 0
2: 4
3: 53
4: 730
1175525880_1175525891 2 Left 1175525880 20:59632997-59633019 CCCACCTTGATCCTGGGGTGCAC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1175525891 20:59633022-59633044 GGGCAGGAAGGAGAGGAGTGTGG 0: 1
1: 1
2: 25
3: 314
4: 2785
1175525880_1175525892 3 Left 1175525880 20:59632997-59633019 CCCACCTTGATCCTGGGGTGCAC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1175525892 20:59633023-59633045 GGCAGGAAGGAGAGGAGTGTGGG 0: 1
1: 1
2: 24
3: 129
4: 1356
1175525880_1175525893 12 Left 1175525880 20:59632997-59633019 CCCACCTTGATCCTGGGGTGCAC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1175525893 20:59633032-59633054 GAGAGGAGTGTGGGAGTTGATGG 0: 1
1: 0
2: 4
3: 53
4: 583

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175525880 Original CRISPR GTGCACCCCAGGATCAAGGT GGG (reversed) Intronic
902311556 1:15585093-15585115 GGGCGCCCTAGGATCAAGGCGGG + Exonic
902821716 1:18947490-18947512 GTACAGCACAGGATAAAGGTTGG + Intronic
905132706 1:35772993-35773015 GAACATCCCAGGTTCAAGGTAGG + Intergenic
908581985 1:65525801-65525823 TTGGACCCCCGGATCAAGGTGGG + Intronic
908619674 1:65963440-65963462 TTGCACCCCTGCAGCAAGGTTGG + Intronic
910208912 1:84774614-84774636 GTGCACCCCAGGCTGTGGGTGGG + Intergenic
913281545 1:117189896-117189918 GTGAAGCCCAAGACCAAGGTAGG + Intronic
916682501 1:167117257-167117279 GTTCTCCCCAGGAACAAGGAAGG + Intronic
917339230 1:173957334-173957356 GTGCACCTCAGGATTCAGGGAGG + Intronic
923841654 1:237679084-237679106 GTGCACCCCAGGACAAACTTTGG - Intronic
1063076186 10:2719115-2719137 GTGAACCACAGGATCAAGAATGG - Intergenic
1064279302 10:13936644-13936666 GTGAAGTCCAAGATCAAGGTGGG - Intronic
1070592270 10:77809649-77809671 GTGCACCCCAAGCTCCAGCTGGG + Exonic
1075621621 10:123932430-123932452 GTCCACCCAAGGAACAAAGTGGG - Intronic
1077485409 11:2836235-2836257 GAGCACCCCAGATTCAAGGCGGG + Intronic
1078542484 11:12223062-12223084 ATGGACCCCAGGACCAAGGGTGG - Intronic
1080114580 11:28607249-28607271 CTGAACCACAGGATCATGGTGGG - Intergenic
1084432946 11:69121763-69121785 GGGCACCCCAGGGTCATGGTGGG - Intergenic
1084731110 11:71074191-71074213 GTGCCCCCCAGGGTCAGGGCTGG + Intronic
1087198753 11:95324223-95324245 GTGCACACCAGATTAAAGGTAGG - Intergenic
1088597457 11:111450830-111450852 GTCCAGACCAGGATCCAGGTGGG + Intronic
1092016473 12:5163132-5163154 GAGCACTCCAGGAGGAAGGTGGG + Intergenic
1092672851 12:10882898-10882920 ATGGTCCCCAGAATCAAGGTTGG + Intronic
1092676860 12:10930440-10930462 ATGGTCCCCAGAATCAAGGTTGG - Intronic
1093566866 12:20616649-20616671 GTTAAGCCCAGGATAAAGGTAGG + Intronic
1096997106 12:55845414-55845436 TCACAGCCCAGGATCAAGGTGGG + Intergenic
1102414126 12:112745825-112745847 GTGCACCACAGGGTCAGGGGAGG + Intronic
1103738782 12:123077853-123077875 GTGCACCACAGGAGCCAGGCTGG + Intronic
1104282672 12:127392108-127392130 GTGCCCGCCAGGACCAAAGTAGG - Intergenic
1106497379 13:30292631-30292653 GGGCTCCCCAGGATGAAGGGAGG - Intronic
1109237775 13:59845529-59845551 GAGCACCCCAGGTTGTAGGTGGG - Intronic
1112624807 13:101092239-101092261 AGGCCCCCCAAGATCAAGGTAGG + Intronic
1113699968 13:112377099-112377121 TTGCAGCCAAGGATCAGGGTGGG + Intronic
1114999202 14:28401296-28401318 GTTCACCCAAGGACCAAGATGGG + Intergenic
1118303287 14:64633766-64633788 GGGCCCCCCAGGCTGAAGGTGGG - Intergenic
1123122803 14:105925881-105925903 GTGGAACCCAGGAGCAAGCTGGG - Intronic
1125589262 15:40844364-40844386 GAGCACCCCAGGATCGAAGAGGG - Intronic
1125867862 15:43070457-43070479 GTCCAGGCCAGGATCAAAGTGGG + Intronic
1129261537 15:74370858-74370880 GGGCAACCAAGGATTAAGGTAGG + Intergenic
1132645302 16:996802-996824 GAGCACCCCAGGGTCAGGGCTGG + Intergenic
1134412669 16:14016042-14016064 CAGTACCCCAGGATCAAGATGGG + Intergenic
1136605526 16:31331074-31331096 GTGCACCCCTGAATCAAGTGGGG - Intronic
1140217414 16:73019602-73019624 GTGCATCTCAGGGTGAAGGTGGG - Intronic
1141296541 16:82774976-82774998 CTGCAGCCCAGGAGCAAGATTGG + Intronic
1141700244 16:85639044-85639066 GTGCAACCCAGGATCAACTCAGG - Intronic
1142792230 17:2276327-2276349 GTTCACCACAGGATCATGTTAGG + Intronic
1144210617 17:13011930-13011952 GTGCAGCCCAGAAACCAGGTAGG - Intronic
1144649372 17:16997764-16997786 CTGCACCCCAGGTTCCTGGTCGG + Intergenic
1144753844 17:17667928-17667950 GTGCCCCCCAGGAGCAAGCCAGG + Intergenic
1146947119 17:36881113-36881135 GTGCACCCCCACATCAAGGCAGG + Intergenic
1151680300 17:75619516-75619538 ATGCACCCCAGGATCCAGGCTGG - Intergenic
1151944946 17:77314679-77314701 GTGTACTCCTGGAGCAAGGTGGG + Intronic
1152252084 17:79217588-79217610 GAGCACCCAAGGATGAGGGTGGG + Intronic
1152756203 17:82088088-82088110 GGGTACCCCAGGACCAAGGCGGG - Intronic
1159138911 18:64369340-64369362 GTTCACCCAAGGACCAAGATGGG + Intergenic
1160377190 18:78421908-78421930 CTGCAGTCCTGGATCAAGGTTGG + Intergenic
1162226368 19:9225966-9225988 GAGCAGCCCAGGAGCAAGCTTGG - Intergenic
1162899321 19:13785226-13785248 GAGCACCCCAGGGGCAAGGAAGG + Intergenic
1165048444 19:33125216-33125238 GTGTACCCCAGGATCAGTGTGGG + Intronic
1165845043 19:38812754-38812776 GGGCCCCCCAGGATCAGAGTGGG + Intronic
928095727 2:28403928-28403950 GTGCATCCAAGAATCAAGGGGGG - Intronic
930454714 2:51592445-51592467 CAGCACCCCAGGATCACTGTGGG - Intergenic
937846509 2:126584687-126584709 GTGCACTGCAGGTACAAGGTAGG - Intergenic
939377037 2:141381948-141381970 GTGGAGCCCAGGATCTAGGAAGG + Intronic
944880693 2:204010097-204010119 GTGCATCCAATGATCATGGTGGG - Intergenic
946307234 2:218863107-218863129 GTGCCCTCCAAGATCAAGTTTGG + Intronic
946494265 2:220179802-220179824 GTGCATTCAAGGATCAATGTGGG + Intergenic
947118817 2:226797238-226797260 CTGCACCCCAGGAACAGGCTTGG - Exonic
948046410 2:234949086-234949108 GTGCTCCCCAGGATTAATGGAGG - Intergenic
948560774 2:238849532-238849554 GGGTACTCCAGGGTCAAGGTTGG - Intronic
948752101 2:240138790-240138812 GTGCCCCCTAGGATCATTGTGGG + Intergenic
1168958671 20:1853181-1853203 GTGAGACCCAGGATCCAGGTGGG - Intergenic
1171055568 20:21903279-21903301 GTACACCCTAGGAACAAGGGTGG - Intergenic
1171335516 20:24381913-24381935 GTGCATCAGAGGATGAAGGTGGG - Intergenic
1172577420 20:36019892-36019914 GTGGATCCCTGGTTCAAGGTTGG + Intronic
1173593441 20:44242922-44242944 CTGAACCCCATGATCAAGCTTGG + Intergenic
1175525880 20:59632997-59633019 GTGCACCCCAGGATCAAGGTGGG - Intronic
1175790604 20:61737902-61737924 TTGCACCCCAAGACCAGGGTAGG + Intronic
1178889134 21:36506696-36506718 GTGGAGCCAAGGGTCAAGGTCGG + Intronic
1179940696 21:44637523-44637545 GTGCAGACCAGGGTCAAGCTGGG - Exonic
1180106217 21:45619842-45619864 GTTATCCCCAGGATCAATGTGGG + Intergenic
1180199678 21:46216666-46216688 GTGCCCCTCAGGAGCACGGTTGG - Intronic
1184691473 22:46119270-46119292 GTGCATTCCAGGGTCAAGGAAGG + Intergenic
950773678 3:15332266-15332288 GTGGATCCCCGGATCCAGGTAGG - Exonic
956424865 3:69123584-69123606 CTGCCTCCCAGGATCAAGCTGGG + Intergenic
958077880 3:88707870-88707892 GTGCATCCCAGGATGAACGAAGG - Intergenic
961416855 3:126765549-126765571 GTGCGACGCAGGATCCAGGTAGG + Intronic
962425873 3:135268936-135268958 CTTCACCTCAGGCTCAAGGTTGG + Intergenic
963086049 3:141437568-141437590 GTGCTCCTCTGGAACAAGGTGGG + Intronic
963356117 3:144210482-144210504 GTGCACACCCAGATGAAGGTTGG + Intergenic
964148111 3:153490753-153490775 GTGCACCCCAGGGTTAGGGCTGG - Intronic
979026457 4:115583678-115583700 GTGCCCACCAGGATTAAGGATGG + Intergenic
980462426 4:133133448-133133470 ATGGATCCCAGGATAAAGGTGGG - Intergenic
982091110 4:151880671-151880693 GTTCACCCCAGGACCTAGGATGG - Intergenic
982742733 4:159074626-159074648 AACCACCCCAGGATCATGGTGGG - Intergenic
986357282 5:6941179-6941201 GTGCCTCCCAGCATGAAGGTGGG - Intergenic
997819510 5:137051938-137051960 GTACTCCCCAGCATCTAGGTAGG + Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1000228148 5:159289829-159289851 GTGGAAGGCAGGATCAAGGTAGG + Intergenic
1001761805 5:174213893-174213915 GAGGACCCCAGGATAAAGGCAGG - Intronic
1007038867 6:38702966-38702988 GCGGACCCCAGTACCAAGGTGGG - Exonic
1007692149 6:43709419-43709441 GTGCAGACCAGGGTCAAGGGAGG - Intergenic
1013164188 6:107575032-107575054 GTGCGCCCCAGGAGCACAGTGGG - Intronic
1014753252 6:125276306-125276328 GTGAACCCTGGGATCAAGCTGGG - Intronic
1018705744 6:166462077-166462099 GTGCCACCCAGGGTGAAGGTGGG + Intronic
1018729171 6:166636128-166636150 GTGGAGCCCAGGAGCAGGGTGGG - Intronic
1019350020 7:550202-550224 ATGCATCCCAAGATCAAGGAAGG - Exonic
1023648553 7:42344579-42344601 GGGCAGCCCAGGAGCAGGGTGGG + Intergenic
1027935722 7:84599833-84599855 GTGCACACCAGATTAAAGGTGGG + Intergenic
1035041547 7:155931766-155931788 GAGCATCAGAGGATCAAGGTGGG + Intergenic
1035247472 7:157573146-157573168 GTGCACCCCAGCATGGGGGTGGG + Intronic
1035534464 8:380401-380423 GTGTCCCCCAGGACCCAGGTGGG - Intergenic
1036011618 8:4731620-4731642 CTGCACTCCAGGAGAAAGGTGGG + Intronic
1043486886 8:80706550-80706572 GGGCTCCCCAGGAGCAAGGGGGG + Intronic
1048151803 8:131901858-131901880 GGGCAAGCCAGGATGAAGGTGGG - Intergenic
1049038853 8:140097645-140097667 GTGCACCCCAAGATCCAGCTGGG - Intronic
1049758801 8:144322600-144322622 TTGCTCCCCAAGACCAAGGTTGG + Intronic
1058717069 9:107732042-107732064 GTGCACACCAGGCTGAGGGTGGG + Intergenic
1061915654 9:133751876-133751898 GTGCAGCCTAGGATTAAGGGAGG + Intergenic
1062314294 9:135958509-135958531 GTGCACTCCTGAATCAAGGAGGG - Intronic
1186047216 X:5549509-5549531 TTGCACCCCAGAATCAAGTTTGG + Intergenic
1189069652 X:37849859-37849881 TTGCTCCCCAGAATCAAAGTTGG + Intronic
1192269097 X:69561737-69561759 GTGCATTCCAGGGTCAAGTTCGG + Intergenic
1194148159 X:90288847-90288869 GTGCACCCCTTAATAAAGGTAGG + Intergenic
1200494543 Y:3865618-3865640 GTGCACCCCTTAATAAAGGTAGG + Intergenic
1200698335 Y:6380844-6380866 GTGAAGTCCAGGATCAAGGAAGG - Intergenic
1200705768 Y:6441256-6441278 GTGAGGCCCAGGATCAAGGAAGG - Intergenic
1200803104 Y:7404341-7404363 GTGCTCCCCAGGAGCAAAGCAGG - Intergenic
1200936096 Y:8739813-8739835 GTGAAACCCAGGATGAAGGGAGG - Intergenic
1201028343 Y:9723452-9723474 GTGAGGCCCAGGATCAAGGAAGG + Intergenic
1201035779 Y:9783855-9783877 GTGAAGTCCAGGATCAAGGAAGG + Intergenic
1201853684 Y:18517161-18517183 GTGCACCAGATGCTCAAGGTGGG + Intergenic
1201879637 Y:18803223-18803245 GTGCACCAGATGCTCAAGGTGGG - Intronic