ID: 1175525881

View in Genome Browser
Species Human (GRCh38)
Location 20:59632998-59633020
Sequence CGTGCACCCCAGGATCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175525881_1175525890 -6 Left 1175525881 20:59632998-59633020 CCACCTTGATCCTGGGGTGCACG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1175525890 20:59633015-59633037 TGCACGGGGGCAGGAAGGAGAGG 0: 1
1: 0
2: 4
3: 53
4: 730
1175525881_1175525896 23 Left 1175525881 20:59632998-59633020 CCACCTTGATCCTGGGGTGCACG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1175525896 20:59633044-59633066 GGAGTTGATGGGGAGATGAGAGG 0: 1
1: 1
2: 5
3: 75
4: 571
1175525881_1175525891 1 Left 1175525881 20:59632998-59633020 CCACCTTGATCCTGGGGTGCACG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1175525891 20:59633022-59633044 GGGCAGGAAGGAGAGGAGTGTGG 0: 1
1: 1
2: 25
3: 314
4: 2785
1175525881_1175525894 12 Left 1175525881 20:59632998-59633020 CCACCTTGATCCTGGGGTGCACG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1175525894 20:59633033-59633055 AGAGGAGTGTGGGAGTTGATGGG 0: 1
1: 0
2: 2
3: 19
4: 301
1175525881_1175525893 11 Left 1175525881 20:59632998-59633020 CCACCTTGATCCTGGGGTGCACG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1175525893 20:59633032-59633054 GAGAGGAGTGTGGGAGTTGATGG 0: 1
1: 0
2: 4
3: 53
4: 583
1175525881_1175525895 13 Left 1175525881 20:59632998-59633020 CCACCTTGATCCTGGGGTGCACG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1175525895 20:59633034-59633056 GAGGAGTGTGGGAGTTGATGGGG 0: 1
1: 0
2: 1
3: 38
4: 493
1175525881_1175525892 2 Left 1175525881 20:59632998-59633020 CCACCTTGATCCTGGGGTGCACG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1175525892 20:59633023-59633045 GGCAGGAAGGAGAGGAGTGTGGG 0: 1
1: 1
2: 24
3: 129
4: 1356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175525881 Original CRISPR CGTGCACCCCAGGATCAAGG TGG (reversed) Intronic
900495990 1:2976453-2976475 GGTGGACACCAGGATCCAGGTGG - Intergenic
902311555 1:15585092-15585114 GGGGCGCCCTAGGATCAAGGCGG + Exonic
903225959 1:21894385-21894407 CTGGGACCCCAGGATCAGGGAGG + Intronic
906725924 1:48044169-48044191 TGTGCAGCCCAGGCTCAGGGAGG + Intergenic
908581984 1:65525800-65525822 GTTGGACCCCCGGATCAAGGTGG + Intronic
913068657 1:115280379-115280401 CATGCACCCCTGGCTCCAGGGGG - Intergenic
913242633 1:116842887-116842909 TGTGCACTGCAGGAGCAAGGAGG - Intergenic
1063885215 10:10570278-10570300 TGTGCATCCCAGGAGCAGGGTGG + Intergenic
1065126357 10:22577883-22577905 CGTTCAAGCCAGGATCCAGGCGG - Intronic
1076021421 10:127076854-127076876 CCTGCACCCCAGGGACAAGCAGG - Intronic
1077485408 11:2836234-2836256 AGAGCACCCCAGATTCAAGGCGG + Intronic
1080114581 11:28607250-28607272 CCTGAACCACAGGATCATGGTGG - Intergenic
1081727088 11:45337881-45337903 CGTGCAACCCAAGATCAAGTGGG - Intergenic
1084432947 11:69121764-69121786 TGGGCACCCCAGGGTCATGGTGG - Intergenic
1086761963 11:90642582-90642604 TTTGCACCCCAGGATCATTGTGG - Intergenic
1096997105 12:55845413-55845435 CTCACAGCCCAGGATCAAGGTGG + Intergenic
1104820272 12:131673048-131673070 TGTGGACACCAGGATGAAGGAGG + Intergenic
1105327766 13:19385596-19385618 CGGGCATCCCAGGGCCAAGGTGG + Intergenic
1105864137 13:24444086-24444108 CGGGCATCCCAGGGCCAAGGTGG - Intronic
1105946220 13:25192282-25192304 TGTGCACCCCACGAACATGGAGG + Intergenic
1122073619 14:99221626-99221648 CGTGGGCCCCAGGCTCGAGGAGG + Intronic
1122301655 14:100734542-100734564 CGTGCACCCCAGGGGTCAGGCGG - Exonic
1122605779 14:102946765-102946787 CACGCACCCCAGGAGCAACGGGG + Intronic
1123122804 14:105925882-105925904 CGTGGAACCCAGGAGCAAGCTGG - Intronic
1123995629 15:25716173-25716195 CGGGCACCCCAGGCACAGGGAGG + Intronic
1124340537 15:28886813-28886835 CCTGCAGCCCAGGAGCAACGGGG - Intronic
1125589263 15:40844365-40844387 GGAGCACCCCAGGATCGAAGAGG - Intronic
1128664454 15:69527965-69527987 CAGGAAACCCAGGATCAAGGAGG + Intergenic
1136605527 16:31331075-31331097 TGTGCACCCCTGAATCAAGTGGG - Intronic
1137539681 16:49353702-49353724 AGTGGAGCCCAGGATAAAGGGGG + Intergenic
1142565514 17:837590-837612 TGGGCCCCCCAGGAACAAGGGGG - Intronic
1142676495 17:1516668-1516690 CGCGCACCCCGGGATCTGGGTGG + Exonic
1143574844 17:7786230-7786252 CGTGCAGCCCACGATCATGGTGG - Exonic
1146478164 17:33179885-33179907 TCTGCACCCCTGCATCAAGGAGG - Intronic
1148215294 17:45830790-45830812 AGTGCAGCCCAGGCTCCAGGGGG - Intronic
1152744297 17:82031932-82031954 CGTGCGCCCCGGGGTCGAGGAGG + Intronic
1152756204 17:82088089-82088111 GGGGTACCCCAGGACCAAGGCGG - Intronic
1152991231 18:365747-365769 CCTGAACCACAGGGTCAAGGAGG - Intronic
1154938165 18:21082473-21082495 AGTACACACCAGGATCAAGTGGG + Intronic
1163519706 19:17784630-17784652 CGTGCATCGCAGGGTCAAGGTGG + Intronic
1165048443 19:33125215-33125237 TGTGTACCCCAGGATCAGTGTGG + Intronic
1168309864 19:55454988-55455010 CGTCCACCCCCAGTTCAAGGAGG - Exonic
924971182 2:128290-128312 CGGGCTCCTCAGGAGCAAGGAGG + Intergenic
926121321 2:10242696-10242718 GGTGCACCCCAGGCTCCAAGGGG - Intergenic
928095728 2:28403929-28403951 TGTGCATCCAAGAATCAAGGGGG - Intronic
931693043 2:64851603-64851625 TATGCAACCCAGGAGCAAGGTGG + Intergenic
938766604 2:134464110-134464132 CCTCAACCCCAGGAGCAAGGTGG + Intronic
946294032 2:218768989-218769011 CTTGCATCCCAGGATGAAGCAGG + Intergenic
1173786121 20:45793963-45793985 CCTGCAGCCCAGCATCAACGAGG + Exonic
1175525881 20:59632998-59633020 CGTGCACCCCAGGATCAAGGTGG - Intronic
1178233468 21:30814197-30814219 CATGCACCCCAGGATAAAGAAGG + Intergenic
1179376350 21:40853018-40853040 CGTGCATTGCAGGATCAAGGTGG - Intergenic
1181368530 22:22398487-22398509 CCAGCAGCCCAGGATGAAGGAGG - Intergenic
1184176786 22:42793482-42793504 CCTGCAGCCCAAGACCAAGGGGG + Intergenic
1185048330 22:48540278-48540300 CCTGCTCCCCAGGACCAGGGCGG + Intronic
951870866 3:27360675-27360697 CAAGCACCCCAGGGTCCAGGAGG - Intronic
952924923 3:38313802-38313824 CGTGGTCCCCAGCATCATGGAGG + Exonic
957574505 3:81990540-81990562 CTTGCACCCAAGAAGCAAGGTGG - Intergenic
962204509 3:133423861-133423883 CTGGCTTCCCAGGATCAAGGTGG - Intronic
968213725 3:196869976-196869998 CATGCATGCCAGGATGAAGGAGG - Intronic
981646954 4:147009761-147009783 CATGCACCTCAGGAAAAAGGCGG - Intergenic
982213202 4:153057800-153057822 CTTGCAGCCCAGGTGCAAGGAGG - Intergenic
985118231 4:186613301-186613323 CTTGCTCCTCACGATCAAGGGGG + Exonic
987001353 5:13663427-13663449 CATGCAACCCAGGATCCTGGTGG + Intergenic
991294016 5:65061921-65061943 AGTGAACCCCAGGGTCCAGGAGG - Intergenic
998116721 5:139543450-139543472 CGTGCAATCCAGGATCTACGTGG - Intronic
1003026008 6:2556453-2556475 CGTGCACCCCAGGGCCTACGAGG + Intergenic
1004206028 6:13592442-13592464 AGTGCCCACCAGGATGAAGGGGG - Intronic
1007038868 6:38702967-38702989 CGCGGACCCCAGTACCAAGGTGG - Exonic
1013164189 6:107575033-107575055 CGTGCGCCCCAGGAGCACAGTGG - Intronic
1014209823 6:118696589-118696611 AGTGAGCCCCAGGATCAATGGGG + Intronic
1015862863 6:137698814-137698836 TGTTCAGCCCAGGATCAAGCCGG - Intergenic
1018613734 6:165665191-165665213 CGTGGACACCAGTATGAAGGAGG - Intronic
1019403116 7:867750-867772 CTCCCACCCCAGGACCAAGGTGG + Intronic
1019408061 7:894281-894303 CGGGCACACCAGGCTCACGGAGG - Intronic
1023796674 7:43799200-43799222 CCTGCACCTCAGGAGCAAGGAGG - Intronic
1023978776 7:45053647-45053669 TGGGCTCCCCAGGAGCAAGGGGG - Intronic
1029282887 7:99448061-99448083 CGTGTCCCCCAGGCTCAGGGTGG + Intronic
1029422389 7:100478100-100478122 CAGGCACCCCTGGAACAAGGGGG + Exonic
1036011617 8:4731619-4731641 CCTGCACTCCAGGAGAAAGGTGG + Intronic
1042879663 8:73473059-73473081 GGTGCACGCCAGCATGAAGGAGG + Intronic
1043486885 8:80706549-80706571 TGGGCTCCCCAGGAGCAAGGGGG + Intronic
1049038854 8:140097646-140097668 TGTGCACCCCAAGATCCAGCTGG - Intronic
1049341095 8:142113079-142113101 CGTGCTCCCCAGAATAAGGGGGG + Intergenic
1056841594 9:90002370-90002392 CAGGGATCCCAGGATCAAGGGGG - Intergenic
1060670094 9:125461218-125461240 AGTGCACCACAGGATAAAGGTGG - Intronic
1062307780 9:135919505-135919527 TGTGCACCCCAAGATGACGGGGG - Intergenic
1062314295 9:135958510-135958532 TGTGCACTCCTGAATCAAGGAGG - Intronic