ID: 1175526722

View in Genome Browser
Species Human (GRCh38)
Location 20:59639339-59639361
Sequence GTGGGAAATGCTCATCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175526722_1175526729 26 Left 1175526722 20:59639339-59639361 CCTGCAGGATGAGCATTTCCCAC 0: 1
1: 0
2: 2
3: 14
4: 125
Right 1175526729 20:59639388-59639410 AGGACCTCACAGCAATGCTCTGG 0: 1
1: 0
2: 3
3: 33
4: 279
1175526722_1175526727 6 Left 1175526722 20:59639339-59639361 CCTGCAGGATGAGCATTTCCCAC 0: 1
1: 0
2: 2
3: 14
4: 125
Right 1175526727 20:59639368-59639390 GTTCTTTTCTCTTGGCCAAGAGG 0: 1
1: 0
2: 4
3: 25
4: 242
1175526722_1175526725 -2 Left 1175526722 20:59639339-59639361 CCTGCAGGATGAGCATTTCCCAC 0: 1
1: 0
2: 2
3: 14
4: 125
Right 1175526725 20:59639360-59639382 ACCTGTCTGTTCTTTTCTCTTGG 0: 1
1: 0
2: 3
3: 56
4: 548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175526722 Original CRISPR GTGGGAAATGCTCATCCTGC AGG (reversed) Intronic
906207523 1:43995141-43995163 GAGGGAGATCCTCATCCTGCAGG + Exonic
906661182 1:47583430-47583452 GTGGGTGCTGCTCAGCCTGCAGG - Intergenic
907888934 1:58619833-58619855 GTGGGAATTGTGCATGCTGCAGG + Intergenic
909581252 1:77238143-77238165 GTTGCAAAGGCTCATTCTGCAGG + Intergenic
914420838 1:147527108-147527130 CTGGGACATCCTCATCCTGTAGG + Intergenic
923408025 1:233682168-233682190 GTGTCAAATGCTCAGTCTGCAGG - Intergenic
1063196821 10:3751084-3751106 GAGGGAAAAGCTTCTCCTGCTGG - Intergenic
1065861088 10:29872892-29872914 GTGGGAATTTCTCTCCCTGCTGG + Intergenic
1067088369 10:43254455-43254477 GTGGGCTGTGCTCTTCCTGCTGG + Intronic
1071073875 10:81728624-81728646 GTTGGAAATGATCCTCCTGCAGG + Intergenic
1074916920 10:117965958-117965980 TTGGGAAATGTTAATTCTGCAGG + Intergenic
1080633016 11:34096910-34096932 GTGGAAAATACTTATCCTCCAGG - Intronic
1083070745 11:59977995-59978017 GTGGGTAATGTTCATCATTCTGG - Intergenic
1083163460 11:60869530-60869552 GGTGGAAACGCCCATCCTGCAGG - Exonic
1084748361 11:71187940-71187962 CTTGGAAATGCTCTTCCTACTGG + Intronic
1085707473 11:78799776-78799798 CTGTAAAATGCTCATGCTGCGGG - Intronic
1086665897 11:89481833-89481855 CTGGGCAATGCTCAGCCTGGAGG - Intronic
1087757826 11:102073588-102073610 GTGGAGAAAGCTCATCCTGAGGG + Intronic
1090407620 11:126486585-126486607 GTGGGAAAAGCCCATCATGGTGG + Intronic
1091445887 12:543956-543978 GTGTGGGATGCTCATCCTCCTGG + Intronic
1091445943 12:544166-544188 GTGTGGGATGCTCATCCTCCTGG + Intronic
1091816844 12:3445223-3445245 GAGGGAAATGCTAACCCTCCTGG + Intronic
1091933367 12:4415139-4415161 TTGGGATATGCTCAGCCTCCAGG + Intergenic
1093779204 12:23114202-23114224 TTTGTAAATGCTCATCCTGAAGG - Intergenic
1097603105 12:61719472-61719494 GTGGGAAATGGTCCTCCTGTGGG - Intronic
1099312317 12:81042281-81042303 CTGGGATATGCTCATGCAGCAGG - Intronic
1100590292 12:96021447-96021469 ATGGGAAATGCGCTTCCTGTAGG - Intronic
1102002127 12:109563841-109563863 GTGGGAAGGGCTGACCCTGCGGG + Intronic
1102992524 12:117325226-117325248 CTGGAAAATGCTCATCCTCCCGG - Intronic
1106118403 13:26837267-26837289 GTGGGCAAAACTCACCCTGCTGG - Intergenic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106885376 13:34179096-34179118 ATGAGTAATGCTCTTCCTGCTGG + Intergenic
1113523740 13:110957929-110957951 GGGGGAAATGTTCATCCTCGGGG + Intergenic
1114622663 14:24106050-24106072 CTGGGTAATGCTGATGCTGCCGG + Intronic
1121019847 14:90573234-90573256 TTGGGGAATGCTCATCCTGCAGG + Intronic
1122611116 14:102984196-102984218 GTGGGAAATGCCAACCCTGGGGG - Intronic
1126415512 15:48413965-48413987 GTGATAAATGCTCATCCTGTGGG + Intronic
1127725419 15:61744772-61744794 CTGGGAAATGCTCCTGTTGCTGG - Intergenic
1132932253 16:2464657-2464679 ATGGGAAAGGCTCAGACTGCAGG - Exonic
1133911514 16:10070316-10070338 CTGGGAGATGCTGATGCTGCTGG - Intronic
1135951470 16:26918301-26918323 TTGGGAAAAGCTCCTCCTTCTGG + Intergenic
1138993911 16:62425095-62425117 GTGGGAAATGGTCCTCATGCAGG - Intergenic
1140477244 16:75245159-75245181 TTGGGAAATGCTTGTCTTGCTGG - Intronic
1142213971 16:88821918-88821940 TGGGGACCTGCTCATCCTGCTGG + Intronic
1143252771 17:5535322-5535344 GAGGGTGATGCTCATGCTGCTGG + Intronic
1144397643 17:14860708-14860730 GTGAGAAATGCTTAGCTTGCGGG - Intergenic
1145208293 17:20996043-20996065 GTGGGATATGCTCATCTTGGAGG + Intergenic
1146823590 17:36004093-36004115 GTGGGAAATTCACCTCCTGTAGG + Intergenic
1148100542 17:45087907-45087929 TTAGGCAATGCCCATCCTGCAGG - Intronic
1148791173 17:50173826-50173848 ATGGGCCATGCTCCTCCTGCGGG - Intronic
1151285205 17:73105896-73105918 ATGGGAATTGGACATCCTGCCGG + Intergenic
1151741253 17:75983781-75983803 GTGGCAAATGGTCCTCCTGCAGG + Intronic
1151884453 17:76915398-76915420 GTGGGAAATGCTCTCCCCTCCGG - Intronic
1152028607 17:77827459-77827481 GCAGGAAATCCACATCCTGCAGG + Intergenic
1158088266 18:53680186-53680208 GTGGGAAATTCACCTCCAGCAGG + Intergenic
1159404206 18:67978039-67978061 GTGGGAAAAGCTCTTCCTGGAGG + Intergenic
1159666580 18:71168839-71168861 GTGGGAAATAGAAATCCTGCAGG + Intergenic
1163134203 19:15297682-15297704 GTGGGAGATGCCCCACCTGCTGG + Intronic
1168079375 19:53998348-53998370 GGGGGAAATGCTGAGCGTGCTGG + Intronic
1168543416 19:57231276-57231298 CTGGGCAAAGCTCAACCTGCAGG + Exonic
927504298 2:23603202-23603224 GTGAGAAATGCCCACCCTGTAGG + Intronic
927585837 2:24304195-24304217 GTGGGAAGTGCTGCACCTGCTGG - Intronic
927599464 2:24427975-24427997 GTCTGAGATGCTCATCCTTCTGG + Intergenic
928610646 2:32988694-32988716 GTGGGAAAGGCTGATCCTGAAGG - Intronic
928611015 2:32992819-32992841 GTGAGAGATGCTCCTCCAGCGGG + Intronic
928908410 2:36393060-36393082 GAGGGAAATGGTCTTCCTGTGGG + Intronic
932169862 2:69544448-69544470 ATGGGAAGTGCTCATTCTGATGG - Exonic
934591839 2:95560458-95560480 GTGGGAAATTCTCACACTGCAGG - Intergenic
944308365 2:198203653-198203675 ATGGGCAATACTCATTCTGCCGG - Intronic
946682983 2:222237095-222237117 GAGAGAAATCCTCATCCTCCTGG - Intronic
948013237 2:234666884-234666906 GTGAGACCTGCTCAGCCTGCAGG - Intergenic
1169343453 20:4812972-4812994 GTGGGAAAAGCAGACCCTGCAGG + Intronic
1169892948 20:10473349-10473371 GTGGGAGATACTAATGCTGCTGG - Intronic
1172815691 20:37684248-37684270 GGGGGAAATGTGCATCCTGTGGG + Intergenic
1173760063 20:45552082-45552104 ATGGGCACTCCTCATCCTGCAGG + Exonic
1174145779 20:48451570-48451592 GTGCGTCCTGCTCATCCTGCAGG + Intergenic
1174668391 20:52282542-52282564 TTGATAAATGCTCTTCCTGCTGG + Intergenic
1175499472 20:59439657-59439679 GTGGTCTATGGTCATCCTGCAGG - Intergenic
1175526722 20:59639339-59639361 GTGGGAAATGCTCATCCTGCAGG - Intronic
1175867269 20:62185873-62185895 GTGGGATTTGTTCATCCGGCAGG + Intronic
1175877146 20:62235748-62235770 CTGAGAAATGCTCATCCTGCAGG - Intronic
1177831847 21:26148094-26148116 GTGGGTAATGCTCATGCCTCAGG - Intronic
1180784792 22:18540881-18540903 CTGGGAAATGCTCTTCCTAGAGG + Intergenic
1181128374 22:20714936-20714958 CTGGGAAATGCTCTTCCTGGAGG + Intronic
1181241696 22:21480238-21480260 CTGGGAAATGCTCTTCCTAGAGG + Intergenic
1182437780 22:30341652-30341674 AGGGGAAAAGGTCATCCTGCAGG + Intronic
949830000 3:8204110-8204132 CTGGGTAATGCTGATGCTGCTGG + Intergenic
950476078 3:13215731-13215753 GTGGGAATTGCTGATCATACCGG - Intergenic
950714655 3:14839154-14839176 GTGGGAAATGCACAGGCTTCTGG + Intronic
960756244 3:121016933-121016955 TTGGGTAATGCTAATCCTCCAGG - Intronic
964107091 3:153050990-153051012 CTGGGAAATGTTCATCAGGCAGG - Intergenic
964700468 3:159560390-159560412 GTCGGAAAGCCACATCCTGCAGG - Intronic
965596909 3:170419270-170419292 GGTGGACATCCTCATCCTGCCGG + Exonic
965654189 3:170966365-170966387 GTGGGAAATGCTGATAATGGGGG - Intergenic
966072604 3:175896776-175896798 GTGGCAGAGGCTCATACTGCTGG - Intergenic
967281233 3:187826056-187826078 GTGGGAACTGCTCTGCATGCTGG - Intergenic
968438443 4:608491-608513 GAGGGAAAGGCCCTTCCTGCAGG - Intergenic
968621588 4:1605675-1605697 GTGGGCAGAGCTCACCCTGCAGG - Intergenic
969156565 4:5216226-5216248 CTAGGAAATGCTGATGCTGCTGG + Intronic
977808194 4:101328025-101328047 GTGGGAAAATTTCTTCCTGCTGG - Intronic
979083607 4:116376298-116376320 GTGGGGAATGCTCATAGTGTGGG - Intergenic
983396041 4:167196847-167196869 GTGGGAAAAGATTGTCCTGCTGG - Intronic
985024141 4:185722773-185722795 GTGTTAAAAGCTCATGCTGCTGG - Intronic
986960047 5:13200744-13200766 GTTGGCAATGCTCCTCCTTCTGG - Intergenic
992386987 5:76294100-76294122 GTGGGGGATGATGATCCTGCTGG + Intronic
995851103 5:116546586-116546608 TTGGGTGATGCTCATGCTGCTGG + Intronic
1002930051 6:1627420-1627442 GTGGCAAATGCTCATACAACGGG + Intronic
1006113272 6:31761645-31761667 CTGGGAAATGCCCAGCCTGGGGG - Intronic
1006751723 6:36382394-36382416 CTGGGTAATGCTGATGCTGCTGG - Intronic
1014974923 6:127868454-127868476 TTGGGAAATGCTGATCTTGAAGG - Intronic
1018346097 6:162900502-162900524 GTTCCAAATGCTCTTCCTGCAGG - Intronic
1018683509 6:166284149-166284171 GTGGGAGCTGCTCATCCTACTGG - Intergenic
1018683515 6:166284197-166284219 GTGGGAGCTGCTCGTCCTACTGG - Intergenic
1022766559 7:33418724-33418746 CTGGGAAAGGCTTCTCCTGCAGG - Intronic
1022822511 7:33974922-33974944 GAGGGAAAAGCTCATCCACCTGG + Intronic
1024752653 7:52486565-52486587 GTAGGAACTGGTCAGCCTGCAGG + Intergenic
1026338000 7:69411291-69411313 GTGGGAAATGCTGGACCTGGTGG - Intergenic
1028525950 7:91786889-91786911 GAGAGAAATGCTGTTCCTGCAGG - Intronic
1030673810 7:112364696-112364718 GTGGTAAGTTCTCATCCTGTTGG + Intergenic
1031388356 7:121181136-121181158 GTGAGAGATGATCATACTGCAGG + Intronic
1031969482 7:128053864-128053886 CGGGGAAAAGCTCAGCCTGCCGG - Intronic
1034946174 7:155263295-155263317 GAGGGAAGTGCTCACCCTGAGGG - Intergenic
1035226963 7:157439012-157439034 CTGGGAGATGCTCACGCTGCTGG + Intergenic
1035643073 8:1198492-1198514 CTGGGGGATGCTCATCCTTCTGG - Intergenic
1039073167 8:33664292-33664314 TTGGGAAATAGTCTTCCTGCAGG + Intergenic
1046313429 8:112468890-112468912 TTTGGAAATATTCATCCTGCAGG - Intronic
1048460769 8:134619912-134619934 GTGGGAAGCGCTCACCTTGCAGG - Intronic
1049409311 8:142465317-142465339 ATGGGAAAGGGTCATCCTCCTGG + Intronic
1054251154 9:62718504-62718526 GTGGGAAATCCCCAAGCTGCGGG - Intergenic
1056112301 9:83408035-83408057 TTTGGGAATGCTCATCTTGCAGG - Intronic
1057020752 9:91695902-91695924 ATGGGACATTCACATCCTGCTGG - Intronic
1059884391 9:118728913-118728935 GTGGGAGATGTTCTTCCTGGTGG + Intergenic
1060870517 9:127036181-127036203 CTGGGAAATGGTCTTCCTGCTGG + Intronic
1186204985 X:7191631-7191653 GGGGGAAGAGCTCTTCCTGCAGG - Intergenic
1188864665 X:35300200-35300222 GTGGTGAATGGTCATCCTTCAGG - Intergenic
1191152839 X:57239524-57239546 CTTGGAAATGGTCATCTTGCAGG + Intergenic
1191611199 X:63115188-63115210 GTGGAAAATGCCCATCTGGCAGG - Intergenic
1192117089 X:68421946-68421968 TTGGGAACTGCTCAACCAGCTGG + Intronic
1193128505 X:77895271-77895293 TTGGGAAAAGCCCATGCTGCTGG + Intronic
1199636452 X:149817367-149817389 GTGAAAACTGCTCTTCCTGCTGG + Intergenic
1201577710 Y:15478544-15478566 GGGGGAAGTGCTTTTCCTGCAGG - Intergenic
1201577769 Y:15478777-15478799 GTGGAAGAAGCTCCTCCTGCAGG - Intergenic