ID: 1175529286

View in Genome Browser
Species Human (GRCh38)
Location 20:59663042-59663064
Sequence CCCTGGGCCTCTCTAGCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175529279_1175529286 4 Left 1175529279 20:59663015-59663037 CCCTTGAAAGTTTCTGGGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 226
Right 1175529286 20:59663042-59663064 CCCTGGGCCTCTCTAGCGTCTGG 0: 1
1: 0
2: 2
3: 12
4: 133
1175529277_1175529286 8 Left 1175529277 20:59663011-59663033 CCTGCCCTTGAAAGTTTCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1175529286 20:59663042-59663064 CCCTGGGCCTCTCTAGCGTCTGG 0: 1
1: 0
2: 2
3: 12
4: 133
1175529281_1175529286 3 Left 1175529281 20:59663016-59663038 CCTTGAAAGTTTCTGGGGCAGGA 0: 1
1: 1
2: 3
3: 16
4: 252
Right 1175529286 20:59663042-59663064 CCCTGGGCCTCTCTAGCGTCTGG 0: 1
1: 0
2: 2
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175529286 Original CRISPR CCCTGGGCCTCTCTAGCGTC TGG Intronic
900192804 1:1358611-1358633 GCCTGGGCCTGTCTACGGTCTGG + Intronic
901247342 1:7742941-7742963 GCCTTGGCCTCTCTAGTATCTGG + Intronic
902070253 1:13728522-13728544 CCCTGGGGCTGCCCAGCGTCTGG + Intronic
903489150 1:23714770-23714792 GCCTGGGCCTCTCCAGTGGCTGG + Intergenic
903858967 1:26353946-26353968 CCCTGGGCCTCTCCAGCTCTAGG - Intronic
904480507 1:30790269-30790291 CACTGGCCCTCACTGGCGTCAGG - Intergenic
908147893 1:61266931-61266953 TCCTGGTACTCTCTAGAGTCAGG + Intronic
912924996 1:113905696-113905718 CCGTGGGCCTGTCTAGCACCTGG + Exonic
913418330 1:118636392-118636414 CCCTGGGCTTCTCTGGGGACTGG + Intergenic
918085982 1:181245724-181245746 CTCTGGCCCTCTCCAGCCTCTGG + Intergenic
920022405 1:202966352-202966374 CACTGGGCCCCTCTAGAGTGTGG - Intronic
920108154 1:203569045-203569067 CCATTGGCCTCTCTAGCCTGGGG + Intergenic
920250949 1:204622143-204622165 CCCTGGGCCTCTGGAGGGTCTGG + Exonic
1063111969 10:3045912-3045934 CCCGGGACCCCTCCAGCGTCTGG - Intergenic
1063392845 10:5661340-5661362 CCTGGGGCCTCTCCAGGGTCAGG + Intronic
1064346850 10:14540465-14540487 TCCTGGGCCTCTCCTGGGTCTGG + Intronic
1068139930 10:52992823-52992845 CCCTGAGCCTCACTAGCATCTGG - Intergenic
1076673150 10:132134048-132134070 CCCTGGGCCGCTCTGTCGTGTGG + Intronic
1076814826 10:132909566-132909588 CCCTGGGCCCCACTAGGGCCTGG + Intronic
1078355595 11:10629487-10629509 CCCTGAGCCCCTCTAGGGTCGGG - Intronic
1080052033 11:27868095-27868117 CCCTGTGCCTCTCTTCCATCTGG - Intergenic
1080648057 11:34201565-34201587 CCCTGAGCCTCTCCAACATCAGG - Intronic
1081595086 11:44453461-44453483 CCCCAGGCCTCTCTGGCATCTGG - Intergenic
1083603178 11:63961478-63961500 CCATGGGCCTCTCTTGTTTCTGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084219416 11:67668067-67668089 CCCTGGGCCTCCCTCCCTTCTGG + Intronic
1084266712 11:68008770-68008792 CCCTGGGCCTCCGTAGCTCCCGG - Intronic
1085217904 11:74848515-74848537 TCCTGGGCCTCACTAGCCTAAGG + Intronic
1089395498 11:118134134-118134156 CCCCAGGCCTCTCTAACATCAGG + Exonic
1091595936 12:1879100-1879122 CCCTGGGCCTGTCCAGAGCCTGG + Intronic
1092181524 12:6450151-6450173 CCCTGGGCCTCTCTTCCCCCAGG + Exonic
1097003976 12:55901813-55901835 CCGTGGGGCTCTCTGGGGTCTGG - Exonic
1101640518 12:106583244-106583266 CCCTGGGCATCTCTAGCACAGGG + Intronic
1106022202 13:25926244-25926266 TCCTGGCCCTCTCCAGCATCTGG + Intronic
1113465868 13:110512585-110512607 CCCTGAGCCCCTCGAGCCTCTGG - Exonic
1113945416 13:114041247-114041269 CCCTGGGCCTCCCAAGCGTGGGG - Intronic
1114266291 14:21074515-21074537 CCCCAGGCCTCTCCAGAGTCCGG + Exonic
1115770099 14:36658702-36658724 CCGCGGGCCGCTCTAGCGCCGGG + Intronic
1115961086 14:38836747-38836769 ACCTCGGCCTCTCTAGCAGCGGG + Intergenic
1116025395 14:39508392-39508414 CCCTGGGCCTTTCTGGGGACTGG - Intergenic
1119266188 14:73264418-73264440 CCCTGGGCCCCTCTAGCGTGAGG - Intronic
1122636196 14:103130816-103130838 CCCAGGCCCTCTCTAGAGTTGGG - Intronic
1124482567 15:30090463-30090485 CCCTGGGCTCCTCTAAGGTCTGG + Intronic
1128269653 15:66297761-66297783 CCCTGGTCCTGTCTGGTGTCTGG + Intronic
1129710974 15:77820059-77820081 CCCTGGGCCCCGCGAGCGGCGGG - Intronic
1132557601 16:579445-579467 CCCGGGGCATCTCTAGTCTCTGG - Intronic
1132684152 16:1155291-1155313 GCCTAGGCCTCTGTAGCCTCAGG + Intronic
1135002867 16:18791226-18791248 CCCAGGGCCTTGCTAGCGTCTGG - Intronic
1140838175 16:78814848-78814870 CCCTTGGGCTCTCTCGCGTGCGG + Intronic
1141818820 16:86431327-86431349 CCCTTGCCCTCTCTAGTCTCAGG - Intergenic
1142468404 17:148555-148577 TCCTGGGCCTCTCTGGGGCCTGG + Intronic
1142733755 17:1881018-1881040 CTCTGGGCCTCTGTGGCGTGGGG + Intronic
1143944966 17:10583081-10583103 CCCTGGTCCTCTCTTGCCACTGG - Intergenic
1144283474 17:13749889-13749911 CTCTGGGCCTCTCTACAGACTGG + Intergenic
1145945045 17:28767588-28767610 CCCTCAGCCTCTCTAGCAGCTGG + Intronic
1148569869 17:48659767-48659789 CCCTGGGCATCTCTTCCATCTGG - Intergenic
1150248163 17:63691335-63691357 CTCTGGGCCTCTGGAGCCTCAGG - Intronic
1150462100 17:65361668-65361690 CCCGGGGCCTCCCCAGCATCTGG - Intergenic
1150745472 17:67813333-67813355 CCCTGGGCCTCTCCAGCCTGCGG + Intergenic
1152143019 17:78549692-78549714 CCCTGGTCCTCTGTAGCGGGTGG + Intronic
1153944952 18:10009956-10009978 CCGTGGTCCTCTCCAGGGTCCGG + Intergenic
1155990961 18:32278949-32278971 CCCTGGGCCTCCCTTGCCTGAGG - Intronic
1156695763 18:39764892-39764914 CCCTGTGCATCTCTATCATCTGG - Intergenic
1157210889 18:45741015-45741037 CCCTTAGCCTCTCTGGCCTCAGG - Intronic
1160488931 18:79320463-79320485 CCCTGGGCCTCTCATGCCCCTGG - Intronic
1160532469 18:79573552-79573574 CCCTGGGCCCCTCCTGCATCGGG - Intergenic
1162822019 19:13228945-13228967 CCCTGGGTCTCCCCAGTGTCTGG - Intronic
1162926216 19:13931719-13931741 TGCTGGGCCTCTCTAGGATCAGG + Intronic
1163825035 19:19518676-19518698 CCCTCGGCCTCCCTAGTATCTGG + Intronic
1164643246 19:29841642-29841664 CCAGGGGCCTATCTAGCCTCAGG + Intergenic
1165345720 19:35248105-35248127 CCCTGGGCATCCCTAGCCCCCGG - Intergenic
1165758103 19:38305626-38305648 CCCTGGCCCTCTGCAGCCTCAGG + Intronic
1167341284 19:48918057-48918079 CCCTGGGCCACACTAGCATGTGG + Intronic
1167530923 19:50015900-50015922 GCCTGGGCTTCTCCAGTGTCAGG + Intronic
925006296 2:445317-445339 CTCTGCATCTCTCTAGCGTCTGG + Intergenic
932578940 2:72980918-72980940 CTCTGGGCTTCTCTACCTTCTGG + Intronic
932593379 2:73080128-73080150 CCCTGGGCCTCAGGAGCCTCAGG + Intronic
936627140 2:114160531-114160553 CCCTTGGCCTCCTTAGCTTCAGG + Intergenic
937887968 2:126913288-126913310 CACTTGGCCTCTCTAGACTCTGG - Intergenic
941916766 2:170818288-170818310 CCCTGGGCCGCTCTCGAGTCTGG - Intronic
943666555 2:190615418-190615440 CCCTGGGCATCTCTTCCATCTGG - Intergenic
943792025 2:191944017-191944039 CCCTGGGCTTCTCCAGCTTAGGG + Intergenic
948216481 2:236237076-236237098 CGCTGGGCCTCCCTAGAGGCCGG + Intronic
948618043 2:239214205-239214227 TCCTGGCCTTCTCTAGCTTCCGG + Intronic
948827317 2:240578909-240578931 CCCTGGGCCTGAGTAGCCTCTGG + Exonic
1169918150 20:10704362-10704384 CCCTGGACCTCTCTAGTGAGTGG - Intergenic
1171215548 20:23350053-23350075 CCCGGGGCCCCTCAAGCCTCAGG + Intergenic
1172038334 20:32026086-32026108 TCCTGGGTCTCTCAAGGGTCTGG - Intronic
1175529286 20:59663042-59663064 CCCTGGGCCTCTCTAGCGTCTGG + Intronic
1180713391 22:17855292-17855314 CCCTGGGCCTCTGTAGGGTTAGG - Intronic
1181369437 22:22404643-22404665 CCCTGGGCATCACTGGCCTCTGG + Intergenic
1183352479 22:37342007-37342029 CCCTGTGCCTGTCTAATGTCAGG - Intergenic
1183468155 22:37990492-37990514 CCCTGAGCCTCTCCAGCTGCTGG + Intronic
1183639190 22:39082971-39082993 CTCTGGGCCTCTCTGGGGTCCGG + Intronic
1183690065 22:39383328-39383350 CCCTGGGCCTCCCATGCCTCAGG - Exonic
1184034215 22:41910909-41910931 CCCTGGGTCTCTCGAGAGGCAGG - Intronic
1184426598 22:44412374-44412396 CCCAGGGCCTCCCCAGCCTCTGG + Intergenic
1184827554 22:46963377-46963399 CCCTGGGCCTTTCCAGCCTTGGG - Intronic
954106200 3:48410987-48411009 CCCTGGGCCTCTCCTGCCCCAGG + Exonic
954286236 3:49621361-49621383 CCCTGGGTCTCTCCAGTGTAAGG + Intronic
954602028 3:51877685-51877707 CCCTGGGCCTCTTTCCTGTCTGG - Intergenic
954628476 3:52035651-52035673 CCCTGTGCCTCTCTAGGGCTGGG + Intergenic
954978018 3:54715292-54715314 CCCTGTGCATCTCTACCATCTGG - Intronic
956860524 3:73319258-73319280 CCTGAGGCCTCTCTAGCCTCAGG + Intergenic
961071494 3:123932982-123933004 CCCTCAGCCTCTCAAGTGTCTGG - Intronic
961771362 3:129252519-129252541 CCTTGAGCCTCTTTAGGGTCTGG + Intronic
963349379 3:144134141-144134163 CCTTGGGCCTCTCTGGCTGCAGG - Intergenic
965543216 3:169890777-169890799 CCCAAGGCCTCTCTATCCTCAGG + Intergenic
969464713 4:7349469-7349491 TCCTGGGCCTCTCCAGGGCCTGG - Intronic
972072413 4:35038356-35038378 CCCAGGGTCTGTCTGGCGTCAGG + Intergenic
997207203 5:132056914-132056936 CACTGGGCCTCTCCGGGGTCCGG + Intergenic
997284200 5:132666759-132666781 CCCTGGGCCTCTCTCATGCCTGG + Intergenic
999201327 5:149818465-149818487 CCCAGGTCCTCTCAAGCGGCCGG - Intronic
1003991703 6:11493000-11493022 CCCTGAGCCTCTCTGCCTTCTGG - Intergenic
1005887497 6:30107930-30107952 CCCTGGGCCCTTCTAGTGCCAGG - Intronic
1006897139 6:37478489-37478511 CCATGGGCCTCTACATCGTCAGG + Exonic
1007721330 6:43887122-43887144 CCCTGGGCCTCCCTGCCCTCTGG + Intergenic
1012499606 6:99874454-99874476 TCCTGAGCCTCTCTAGATTCTGG + Intergenic
1014218941 6:118780852-118780874 CCCTTGGCCTCTCTAGCCTCGGG + Intergenic
1017884245 6:158586076-158586098 ACCTGGGCCTCTTGGGCGTCAGG + Intronic
1019198786 6:170297145-170297167 CCCTGGGCCTGTCTGGCTGCAGG + Intronic
1019308778 7:348810-348832 CCCTGGGCCTTTCTTCCCTCTGG - Intergenic
1019553127 7:1613645-1613667 GCCTGGGCCTCCCTAGCAGCGGG - Intergenic
1019838316 7:3413297-3413319 CCCTGCCCCTCTTTAGCTTCAGG - Intronic
1023779918 7:43646172-43646194 CCCTTGGCCTCTCCAGGGTCAGG - Intronic
1023849856 7:44144613-44144635 CCCTGGGCCTCTTGAGCCTCAGG + Exonic
1027216672 7:76188318-76188340 GCCTGGGCTTCTCTGGAGTCTGG + Intergenic
1027468195 7:78540741-78540763 CCCTGGGCTTCTTTAGGGGCCGG + Intronic
1032171387 7:129587537-129587559 CCCTCGGCCTCCCTAGGGGCTGG - Intergenic
1034295933 7:149972520-149972542 CCCTGCCCCTCTCCAGCCTCTGG + Intergenic
1034810118 7:154124382-154124404 CCCTGCCCCTCTCCAGCCTCTGG - Intronic
1035705234 8:1669975-1669997 CCCTGGGCCTCGCTGGGCTCCGG + Intronic
1039375368 8:37027341-37027363 CCCGGGATCTCTCTAGCATCAGG + Intergenic
1041053310 8:53957895-53957917 GCCTCGGCCTCTCTAGCTGCTGG - Intronic
1042402942 8:68370545-68370567 CTCTGGGCCTTTCTAGAGTGCGG + Intronic
1043883729 8:85574430-85574452 TCCTGGGCCTCTCTAAGCTCTGG + Intergenic
1048989169 8:139751291-139751313 CCCTGGGCATCCCCAGCCTCTGG - Intronic
1049410570 8:142472131-142472153 AGCTGGGCCTCCCTAGCTTCCGG - Intronic
1049624956 8:143615764-143615786 CCCAGGGCCTCTGGAGCCTCTGG - Intronic
1049733530 8:144191516-144191538 CCCTGGGCCTGGCCAGCATCTGG + Intronic
1051474920 9:17495396-17495418 CCCTGGGCCTACATAGGGTCAGG - Intronic
1053135438 9:35647534-35647556 CCCAGGGCCTCTGTAGAGGCGGG - Intergenic
1057172177 9:92969572-92969594 CACTGGGCCACTCCAGCGACAGG + Intronic
1059221996 9:112631409-112631431 GCCTCAGCCTCTCTAGCATCTGG - Intronic
1060973778 9:127753554-127753576 CCCTGGGCCTCTCTGCCCTTCGG - Intronic
1061135049 9:128729090-128729112 CCCTGGGCCATGCTAGAGTCTGG + Intergenic
1197729536 X:129797880-129797902 CCGTGGGCCTCTCCAGGGCCTGG + Intergenic
1200036725 X:153335737-153335759 CACTGGGCCTGTCTAGAATCTGG - Intronic