ID: 1175530563

View in Genome Browser
Species Human (GRCh38)
Location 20:59671971-59671993
Sequence GCCACATTTCAGAATAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175530563_1175530569 11 Left 1175530563 20:59671971-59671993 CCTCCTTTATTCTGAAATGTGGC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1175530569 20:59672005-59672027 CAGCTAGAGATTCTTCCCTAAGG 0: 1
1: 0
2: 2
3: 8
4: 131
1175530563_1175530570 19 Left 1175530563 20:59671971-59671993 CCTCCTTTATTCTGAAATGTGGC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1175530570 20:59672013-59672035 GATTCTTCCCTAAGGAAGTCTGG 0: 1
1: 0
2: 1
3: 11
4: 140
1175530563_1175530573 29 Left 1175530563 20:59671971-59671993 CCTCCTTTATTCTGAAATGTGGC 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1175530573 20:59672023-59672045 TAAGGAAGTCTGGAGTCCCGTGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175530563 Original CRISPR GCCACATTTCAGAATAAAGG AGG (reversed) Intronic
900036950 1:421206-421228 GTCACTTTTCAGGAGAAAGGTGG + Intergenic
900058579 1:656945-656967 GTCACTTTTCAGGAGAAAGGTGG + Intergenic
901640863 1:10692403-10692425 GCCCCATTTCCGAAGAAAGGGGG + Intronic
902284691 1:15399763-15399785 GCCAGTCTTCAGAAAAAAGGAGG + Intronic
903673615 1:25051096-25051118 GCCACAAGACAGAATAATGGTGG - Intergenic
905505233 1:38474178-38474200 GTCATATTTCAGCTTAAAGGTGG - Intergenic
910030695 1:82718546-82718568 ACCAAATTTCAGAATAATGCAGG + Intergenic
910613491 1:89170468-89170490 GCCACATTTGAGCAACAAGGAGG - Intronic
911338636 1:96610914-96610936 GCTAAATTTGAGAATCAAGGGGG - Intergenic
911491059 1:98566639-98566661 ACTACGATTCAGAATAAAGGAGG - Intergenic
911584240 1:99672172-99672194 GCAACATTTCAGAAAATAAGTGG + Intronic
912897554 1:113608897-113608919 TCCACTTTTGAGAATAAAAGGGG - Intronic
913097427 1:115532370-115532392 GCCTTATTTCAGAGTAAAGGGGG + Intergenic
916967965 1:169972864-169972886 ACCACATTTCTGAATACATGAGG + Intronic
919668186 1:200313051-200313073 TCCTCATTTCAGAATGAAGAGGG + Intergenic
919673102 1:200355721-200355743 GCCACAATTCTGAAGTAAGGGGG + Intergenic
921836742 1:219786054-219786076 GACACATTTGAGAATGAAAGGGG - Intronic
923485728 1:234429135-234429157 GGCATATTTCAAAATAAAAGAGG - Exonic
923618646 1:235558904-235558926 ATCACATTTCAGAGTAAAAGAGG + Intronic
923988077 1:239403916-239403938 CCAACATTTCAGAAGGAAGGAGG + Intronic
924027025 1:239844486-239844508 GCTACATTTAAGAATAAATTTGG + Intronic
1064887451 10:20125540-20125562 GGCACATGTCTCAATAAAGGTGG + Intronic
1065043399 10:21720721-21720743 GCCACAGTTCAGAATATAATTGG + Intronic
1068971912 10:62967913-62967935 GCCACATTTCAGAGGAAAAATGG - Intergenic
1069584124 10:69585913-69585935 GGCCCATTTCACAGTAAAGGAGG + Intergenic
1070164644 10:73888480-73888502 GCAACTTGTCAGAATAAAGGAGG - Intergenic
1073117789 10:101101817-101101839 GCCACATTCCAGGTGAAAGGTGG + Intronic
1075809179 10:125211964-125211986 GCCACCTTTCAGAAGATAGCAGG - Intergenic
1075879671 10:125840074-125840096 ACCATCTTTCAGAACAAAGGAGG + Intronic
1079394912 11:20053471-20053493 TATACATTTCAGAATAAATGAGG + Intronic
1079776841 11:24542284-24542306 GTTACATTTCAGAATCATGGAGG + Intronic
1082233799 11:49798630-49798652 GCCACATCTCAGACTATGGGCGG + Intergenic
1084508079 11:69582704-69582726 GCAAAATTTCTGAATTAAGGAGG - Intergenic
1085702626 11:78758508-78758530 GCCACATTTCATAAATAATGTGG + Intronic
1086590645 11:88510020-88510042 ACCAACTTCCAGAATAAAGGCGG - Intronic
1089007414 11:115103963-115103985 GGCACGTTTCAGAAGAATGGAGG + Intergenic
1090163494 11:124520398-124520420 GACATATTTCAGAATGAAAGGGG - Intergenic
1090200142 11:124848235-124848257 GCCCCATTTCTGATTACAGGAGG + Intergenic
1092692828 12:11133528-11133550 GGCACATAACAGAAGAAAGGAGG + Exonic
1094633742 12:32203588-32203610 GGCCCATTTCGGATTAAAGGAGG + Intronic
1095112031 12:38306331-38306353 GTTACATGTCAGAAAAAAGGAGG - Intergenic
1096835855 12:54350847-54350869 GCTACACTTCAGATTAAAGTAGG + Exonic
1099936591 12:89133311-89133333 TCCACATTTCAGAATAATCTTGG - Intergenic
1102586864 12:113929791-113929813 GCCACATCACAGAAAACAGGGGG + Intronic
1103299937 12:119919120-119919142 CCCACATCTCAGAATATGGGCGG + Intergenic
1103861998 12:124022970-124022992 CAAACATTTCAGAATAAATGGGG - Intronic
1107291249 13:38856578-38856600 GCAACATCTCAGAGTAAAGAGGG + Intronic
1108564392 13:51680793-51680815 GCCCCATGTCAGGATAATGGTGG + Intronic
1109192642 13:59344098-59344120 GTCACTTTTCCTAATAAAGGGGG - Intergenic
1109341795 13:61071133-61071155 GTCACATTTTAGCATAAAAGAGG - Intergenic
1109805981 13:67443754-67443776 GCAGCATTGCAAAATAAAGGAGG - Intergenic
1111547161 13:89755132-89755154 GACACATTTCAGAAAAAGGAGGG - Intergenic
1112602410 13:100869264-100869286 GCCACATAGCAAAAGAAAGGAGG - Intergenic
1112720482 13:102238265-102238287 GCCACAATTCAAAATAAAACAGG + Intronic
1118235245 14:63997311-63997333 ACCACATCTGAGAATAGAGGAGG + Exonic
1118886986 14:69875737-69875759 ACCACATTTAAGAGTAAAGCTGG - Intronic
1120332292 14:83108957-83108979 AACACACATCAGAATAAAGGAGG - Intergenic
1120762360 14:88296557-88296579 GCCAGATATCAGAATAGAGCAGG - Intronic
1126485931 15:49180970-49180992 GCCAAAATTCACAATACAGGGGG - Intronic
1126564192 15:50077628-50077650 GACACTTTTGAGAATAAAAGGGG - Intronic
1128305733 15:66597930-66597952 GCCTATTTCCAGAATAAAGGAGG + Intronic
1129290512 15:74563386-74563408 CCCAAATTTGAAAATAAAGGAGG + Intronic
1131858588 15:96626817-96626839 GAAACATTTAAAAATAAAGGGGG + Intergenic
1133659595 16:7903392-7903414 GCCAGCTTCCAGAATAAAAGTGG - Intergenic
1134794180 16:17019399-17019421 GCCACATTTGAAAATCAGGGGGG + Intergenic
1135642259 16:24130842-24130864 GCCACACTTCAGTGCAAAGGAGG + Intronic
1138464999 16:57183231-57183253 TCCAAATTTCAGAATACAGGGGG + Intronic
1139856022 16:69980913-69980935 GTCACACATCAGAATAGAGGTGG + Intergenic
1140610723 16:76595838-76595860 AGCACATTTGAAAATAAAGGTGG - Intronic
1143586908 17:7854971-7854993 GCCGCATTCCAGGATAAGGGGGG + Intergenic
1146328094 17:31904327-31904349 GCTAAATTTCAAAATAAGGGAGG - Intergenic
1146473904 17:33146381-33146403 CCCACATCCCAGAATCAAGGTGG + Intronic
1146537722 17:33667524-33667546 GCCACGTTGCAGAATACAGAGGG + Intronic
1146703725 17:34984252-34984274 GAAATATTTCAGATTAAAGGAGG - Intronic
1147639183 17:41984069-41984091 GCTACAATCCAGAATAGAGGTGG + Intronic
1150322229 17:64224761-64224783 GCCACATCCCAGAGGAAAGGGGG + Intronic
1153068206 18:1072572-1072594 ACCATATTTCAGAATTGAGGTGG - Intergenic
1153455563 18:5278500-5278522 ACCATATTTTAGAATATAGGGGG + Intergenic
1156800903 18:41112419-41112441 GTCACATTTATCAATAAAGGAGG - Intergenic
1158295532 18:55993199-55993221 GCCACTTTACAGAATAAAAGAGG - Intergenic
1159501346 18:69274809-69274831 GCCACATTGGAGCAAAAAGGAGG + Intergenic
1160347649 18:78147222-78147244 ACAACATTTTAGAATAATGGAGG - Intergenic
1160640478 19:128754-128776 GTCACTTTTCAGGAGAAAGGTGG + Intergenic
1164662868 19:29993546-29993568 GGCAGATTTCAGAAGAAAGTGGG + Intronic
1165477528 19:36039858-36039880 GCCAAAGTTCAGACTCAAGGAGG + Intronic
925121088 2:1419040-1419062 ACCACATTTCAGAAAGAAGAAGG - Intronic
925381730 2:3432704-3432726 GCCAGATTTCATAAAAACGGTGG - Intronic
927903841 2:26843335-26843357 GCCACAAACCAGCATAAAGGAGG - Intergenic
930244814 2:48972627-48972649 TCCACATTTGAGAAAAAAAGAGG - Intronic
930303545 2:49648446-49648468 ACCTGATTTCAGAAGAAAGGGGG - Intergenic
930683260 2:54280318-54280340 GCCAAGTTTCAGAATGCAGGAGG + Intronic
932454327 2:71837131-71837153 ACCAAATTACAGAATATAGGAGG + Intergenic
932986915 2:76737352-76737374 GTGACATGTGAGAATAAAGGGGG + Intergenic
934562347 2:95319917-95319939 GCCCCATCTCAGAACAAGGGAGG + Intronic
935560601 2:104555494-104555516 GCCTCATTTCAGAGTCAAAGTGG + Intergenic
937444023 2:121941303-121941325 GCCACATTCCAGGAAATAGGAGG + Intergenic
938729215 2:134133173-134133195 GCCACATTTCTGAATTAGGGTGG + Intronic
939628960 2:144512343-144512365 CCCACATCTTAGAATAAACGCGG + Intronic
945261567 2:207848568-207848590 TCCACATTTTATAATAAAGCAGG + Intronic
945718264 2:213385223-213385245 GCTACATTCCACAACAAAGGAGG - Intronic
946594492 2:221291257-221291279 TCCTAATTTCAGATTAAAGGAGG - Intergenic
948170128 2:235894754-235894776 ATCACACTTTAGAATAAAGGAGG - Intronic
1170505682 20:17023593-17023615 GCCACCTTCCAAAATAAAGTAGG + Intergenic
1171939827 20:31315911-31315933 GACACATTTGAGAATAAAGGGGG + Intergenic
1172376898 20:34450563-34450585 GCAAGGTTTCAGAATAAAGATGG + Intronic
1173341300 20:42155118-42155140 GCCACATTTCAGAATCACTGGGG - Intronic
1174095677 20:48087805-48087827 ACCACTTTTGAGAATAAATGGGG - Intergenic
1175009606 20:55721877-55721899 GACACATTTAAGATGAAAGGAGG - Intergenic
1175461655 20:59156179-59156201 GCCACAGATAATAATAAAGGAGG - Intergenic
1175530563 20:59671971-59671993 GCCACATTTCAGAATAAAGGAGG - Intronic
1176668931 21:9713887-9713909 GCCATATTTCAGAATTAATAGGG - Intergenic
1177455323 21:21330651-21330673 GACACATTTAAAAATAAAGTTGG - Intronic
1179080957 21:38170298-38170320 GCCACTTTTGAGAGTAAAAGAGG + Intronic
1179508387 21:41856342-41856364 GGCAGATTTCAGCAAAAAGGGGG - Intronic
1181654472 22:24284790-24284812 GCAACAGTTCAGAAAGAAGGAGG + Intronic
949230247 3:1742525-1742547 GCCACATGTCAAAATAACTGAGG + Intergenic
949772464 3:7594114-7594136 ACATCATTTCAGAAGAAAGGAGG - Intronic
950827434 3:15839478-15839500 ATCACATTTCAGAATCAATGTGG + Intronic
950973624 3:17216108-17216130 GCCACATTTCAGAAGAAGTGTGG + Intronic
951118365 3:18892374-18892396 TCCACATTTCAGAATATCTGTGG + Intergenic
951406688 3:22308740-22308762 GCCATATTGCAGAATTAAAGTGG + Intronic
952193839 3:31051783-31051805 ACCAGATTTCATGATAAAGGGGG - Intergenic
953209128 3:40858753-40858775 GCGACATTACAGAATTAGGGTGG + Intergenic
954329537 3:49882178-49882200 TCCACATTTCAGAATAGGAGTGG - Intergenic
954349584 3:50032062-50032084 GCCACACTTCAGCTTCAAGGAGG + Intronic
956344934 3:68268284-68268306 GCACCATTTCAGTTTAAAGGAGG + Intronic
957946900 3:87075652-87075674 GACACATTTAAGAATGAAAGAGG - Intergenic
959318392 3:104839040-104839062 TTCACATTTCAGAGTACAGGTGG - Intergenic
959995365 3:112674939-112674961 GCCTCACTTCAGGATAAAGTGGG + Intergenic
960353012 3:116616687-116616709 GAAATATTTCAGAATCAAGGAGG + Intronic
964169923 3:153757815-153757837 GCAAAATTGCAAAATAAAGGTGG - Intergenic
966206512 3:177412035-177412057 GTAACATATCAGAATGAAGGTGG - Intergenic
966305827 3:178533676-178533698 GACCCATCTGAGAATAAAGGAGG - Intronic
967314534 3:188138938-188138960 GCAACATTTCAGACTAAAATGGG - Intergenic
969041928 4:4305474-4305496 GCCACATTTCAGAACAGCTGTGG + Intronic
970015981 4:11513162-11513184 TCCACATTCCAGAAAAAAGAAGG + Intergenic
977182152 4:93889354-93889376 CCCACATTTCATTAAAAAGGGGG + Intergenic
977631937 4:99252669-99252691 GCCAGATTTCAGAACAACTGAGG - Intergenic
979134467 4:117091564-117091586 GCCACAATTCTGAATACAGCAGG + Intergenic
982204933 4:152990492-152990514 GACACATGTCAGAAAAATGGTGG + Intergenic
982713645 4:158783929-158783951 GTCACATTTCAGAGGAAAGCTGG + Intronic
983809940 4:172049621-172049643 TCTACATTTGAGAATAAACGTGG - Intronic
985405852 4:189637626-189637648 GCCATATTTCAGAATTAATAGGG + Intergenic
987085404 5:14463002-14463024 GCCTCATTTCAGGAGACAGGAGG + Intronic
987440797 5:17953721-17953743 CACAAATTTCAGAATAAAGCTGG + Intergenic
990485409 5:56254092-56254114 GCCACTTTTCAGAGTGCAGGTGG + Intergenic
991647931 5:68819741-68819763 GCCAAACTGCAGAATAACGGAGG - Intergenic
992425871 5:76656940-76656962 GTGACATTCCAGAATAAAAGGGG - Intronic
992442934 5:76812216-76812238 CCCACATCTCAGAAGAAGGGCGG - Intergenic
992862786 5:80929038-80929060 CCAAAATTTCAGCATAAAGGGGG + Intergenic
995580371 5:113594040-113594062 GACACATTTAAGAATAAAGTTGG + Exonic
996399594 5:123046954-123046976 GCCACAGTTTAGAAAAAAGAAGG + Intergenic
998860506 5:146439007-146439029 GCCACATTTGAGACTAAAAGGGG - Intergenic
1000573628 5:162947650-162947672 ACCAGATTTCTGATTAAAGGTGG + Intergenic
1000782315 5:165497681-165497703 GCCACAATTCAGGATGCAGGTGG + Intergenic
1002736871 5:181397660-181397682 GTCACTTTTCAGGAGAAAGGTGG - Intergenic
1002747827 6:77157-77179 GTCACTTTTCAGGAGAAAGGTGG + Intergenic
1002777578 6:341907-341929 GCCACATCTCAAAATACAAGAGG - Intronic
1003127687 6:3368550-3368572 GCCACATTTCAACATAAAGTGGG + Intronic
1004337415 6:14776944-14776966 GTCGCAGTTCAGTATAAAGGAGG - Intergenic
1005624237 6:27648286-27648308 GCAGCATTTCAGAGTAAAGCAGG + Intergenic
1008117514 6:47569071-47569093 GCCAAATTAAAGAAGAAAGGAGG + Intronic
1010439992 6:75882692-75882714 GCCACTTTTCACAATAAAATAGG + Intronic
1010640759 6:78323886-78323908 GCCACTTTACACAATAAAGTAGG - Intergenic
1011588034 6:88947255-88947277 CCCACATCTCAGAATATGGGCGG - Intronic
1011588182 6:88947706-88947728 CCCACATCTCAGAATATGGGCGG - Intronic
1012382063 6:98631817-98631839 TCCACAATTCAGAATAAATATGG + Intergenic
1013162367 6:107557729-107557751 GCCAGATTTTAGAATAATGATGG - Intronic
1015745260 6:136503207-136503229 GCCTTCTTTCAGAATAAAGGAGG - Intronic
1017663339 6:156695247-156695269 ACCATATTTCAGTATAAAGTTGG - Intergenic
1018129708 6:160717385-160717407 GACACATGTCAGAGGAAAGGAGG - Intronic
1018343118 6:162872788-162872810 CACTCAGTTCAGAATAAAGGTGG - Intronic
1019241969 6:170673194-170673216 GTCACTTTTCAGGAGAAAGGTGG - Intergenic
1020931170 7:14396838-14396860 GCCAGATCTCTGAATAAAAGAGG + Intronic
1021762876 7:23918376-23918398 TCCACATCTCAGAATAAAAATGG + Intergenic
1024721695 7:52144069-52144091 GCTATATTTCAGATTAGAGGTGG - Intergenic
1025988517 7:66476505-66476527 GTCACTTTTGAGAATCAAGGGGG - Intergenic
1031615311 7:123872639-123872661 GTCACATTACAGAAAAAAGAAGG - Intronic
1034835552 7:154348871-154348893 GCCAAATGGCAGAATAAAGAAGG - Intronic
1035506148 8:134907-134929 GTCACTTTTCAGGAGAAAGGTGG + Intergenic
1037159347 8:15749436-15749458 GCCACATATGAAAATAGAGGGGG - Intronic
1042832089 8:73041667-73041689 TCCCCATTTCAAAATAAATGAGG - Intronic
1045052585 8:98340632-98340654 TCCACATCTCAGAATAGATGGGG - Intergenic
1046649999 8:116827229-116827251 GCTACATTTCAGATTGAAGTTGG - Intronic
1047313023 8:123708332-123708354 GTCACATTTCAGCAGGAAGGGGG + Intronic
1052844201 9:33320541-33320563 GCCACAAATCAGAAGAAAGGGGG - Intronic
1054822986 9:69542750-69542772 GACACTTTTGAGAATAAAAGGGG - Intronic
1055440189 9:76329477-76329499 GAAACATTTCATATTAAAGGAGG - Intronic
1056494358 9:87141505-87141527 TCCACATTGGAGAATAAATGTGG + Intergenic
1056726225 9:89120997-89121019 GCCACTTTACACAATAAAGTAGG + Intronic
1057712530 9:97459979-97460001 GCCACATTTCAGAAATAAAAAGG - Intronic
1060312416 9:122474350-122474372 GCCACATTTGAGCAAGAAGGAGG - Intergenic
1061574803 9:131499510-131499532 GTCACATTTCAGAAGAGAGCTGG - Exonic
1062231371 9:135483724-135483746 GCCAGATTTCAGACCAAAGGTGG - Intronic
1203602160 Un_KI270748v1:22428-22450 GTCACTTTTCAGGAGAAAGGTGG - Intergenic
1203656935 Un_KI270753v1:7048-7070 GCCATATTTCAGAATTAATAGGG + Intergenic
1185609640 X:1386868-1386890 GCCACAGTTCTGATTACAGGAGG + Intronic
1186819412 X:13271715-13271737 GACACATTCCAGGAAAAAGGAGG + Intergenic
1187122643 X:16424021-16424043 GGCACATAGCAGAATAGAGGAGG + Intergenic
1188107058 X:26158901-26158923 TGCACATTTCAGAAGAGAGGAGG + Intergenic
1190178806 X:48174003-48174025 GCCACATTTGAGCAAAAAAGAGG + Intergenic
1190185046 X:48226287-48226309 GCCACATTTGAGCAAAAAAGAGG + Intronic
1190263167 X:48811620-48811642 GCCAGATGTCAGAACAAAGGAGG + Intronic
1191684039 X:63870617-63870639 GCTACATTTCAGAAGTAAAGTGG + Intergenic
1192222864 X:69209278-69209300 GCCACATGGCAGCATAGAGGAGG - Intergenic
1192508443 X:71706016-71706038 GTTACATTTCAAAATAAAGAGGG + Intergenic
1192518253 X:71775537-71775559 GTTACATTTCAAAATAAAGAGGG - Intergenic
1194691843 X:96995528-96995550 GCCACATTTCAAAATAAAATTGG + Intronic
1195051094 X:101097763-101097785 CGCAAATTTCACAATAAAGGTGG - Intergenic
1195143527 X:101988578-101988600 GCCACATTTAACAATAAAAATGG - Intergenic
1199997850 X:153037760-153037782 GACACACTTCAGAGTGAAGGAGG + Intergenic