ID: 1175532530

View in Genome Browser
Species Human (GRCh38)
Location 20:59683988-59684010
Sequence AAGAACGCAGAGAGGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175532525_1175532530 19 Left 1175532525 20:59683946-59683968 CCTTAGGACTATGTATTTTCTGA 0: 1
1: 0
2: 1
3: 14
4: 232
Right 1175532530 20:59683988-59684010 AAGAACGCAGAGAGGGGCAATGG 0: 1
1: 0
2: 3
3: 29
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175532530 Original CRISPR AAGAACGCAGAGAGGGGCAA TGG Intronic
900679005 1:3905881-3905903 AAGGGGGCAGAGAGGGGCCAGGG - Intergenic
900700793 1:4047531-4047553 GAGAACACAGAGATGGGGAAGGG + Intergenic
902280763 1:15372410-15372432 AAGAACGCAGAGGAGAGCAAAGG - Intronic
902543931 1:17174350-17174372 TAGCACACAGAGTGGGGCAAGGG - Intergenic
902714922 1:18265995-18266017 AAGCCCGGAGACAGGGGCAAGGG + Intronic
905386605 1:37608738-37608760 AGAGACGCAGAGAGGGGCAAAGG + Intergenic
907477756 1:54717170-54717192 AAGAAATCAGTGAGGGGCAGGGG - Intronic
908809870 1:67969599-67969621 AAGAACCCAGAGGGAGGTAATGG - Intergenic
908851028 1:68375810-68375832 AGGGACCCAAAGAGGGGCAATGG - Intergenic
910012270 1:82480161-82480183 AAGTAAGAAGAGAGGGGAAATGG - Intergenic
910200955 1:84697987-84698009 AGGAAGGCAGAAAGGAGCAAAGG + Intergenic
910225252 1:84929898-84929920 AAGAAAGCAGAGAAGAGCCAGGG + Intronic
910434005 1:87187044-87187066 AAGAAAGGAGAGAGGGAGAAAGG - Intergenic
910952905 1:92670485-92670507 ACGAAGGGAGAGAAGGGCAAGGG - Intronic
911463400 1:98219752-98219774 AAGTAGGAAGAGAGGGGCTAAGG + Intergenic
911709607 1:101054830-101054852 AAGAATGAAGAGAAGGGCAAAGG - Intergenic
912191784 1:107349025-107349047 AGGAAGTCAGAGAGAGGCAAGGG - Intronic
912494781 1:110084417-110084439 AAGAGCGCAGTGAGCGGCAGCGG - Intergenic
912511382 1:110192455-110192477 AAGAAGGCAGGGGTGGGCAATGG - Intronic
912544985 1:110444246-110444268 AAAAAGGCACAGAAGGGCAAGGG + Intergenic
913414747 1:118592682-118592704 AACATGGCAGAGAGGGTCAAAGG + Intergenic
913481581 1:119294101-119294123 AAGAGAGGAGAGAGGGGCTAGGG - Intergenic
913514434 1:119591176-119591198 AAGAAAGAACAGAGGAGCAAAGG + Intergenic
913957863 1:143320500-143320522 TAGAACCAAGACAGGGGCAAAGG + Intergenic
914052172 1:144145858-144145880 TAGAACCAAGACAGGGGCAAAGG + Intergenic
914127025 1:144820683-144820705 TAGAACCAAGACAGGGGCAAAGG - Intergenic
914227459 1:145732845-145732867 AAGAATGCAGAGAAGGAAAATGG + Intronic
915717956 1:157962269-157962291 AAGAGTGCAGAGAGGGGGAATGG - Intergenic
917489788 1:175488442-175488464 GGGAATGCAGTGAGGGGCAATGG + Intronic
918511437 1:185317536-185317558 AGGAACGGAGGGAGGGACAAAGG - Intergenic
920288818 1:204901872-204901894 AAGGTGGCACAGAGGGGCAAAGG + Intronic
920674678 1:208030772-208030794 AAGAGCACAGAGAGGGGAGAGGG - Intronic
921263775 1:213405859-213405881 GAGGACTCTGAGAGGGGCAAAGG + Intergenic
921407247 1:214793983-214794005 AGGAAGGCAGGGAGGAGCAAGGG - Intergenic
922162390 1:223088268-223088290 AAGAAAACAGACATGGGCAAGGG - Intergenic
922190672 1:223316106-223316128 AAGGATGCAGAGAGGTGCAGCGG + Intronic
923012170 1:230096491-230096513 AAGAAGGGAGAGAGGGGAAAGGG - Intronic
924527061 1:244863007-244863029 GAGAGCGCAGAGAGGGGGAGGGG + Intronic
1063106876 10:2999648-2999670 CAGAACGCAGAGACGGGAAATGG - Intergenic
1067793323 10:49303596-49303618 AAGAAGGGAAAGGGGGGCAAGGG + Intronic
1067900920 10:50240693-50240715 ATGAACACAGAGAGGCACAAAGG - Intronic
1068621904 10:59195049-59195071 AAGAAAACAGAAAGGGGGAAAGG + Intronic
1069629421 10:69888800-69888822 ATGAACGAAGAGAGGAGCTATGG - Intronic
1069888238 10:71637287-71637309 GAGCAGGCAGAGAAGGGCAAAGG - Intronic
1071444810 10:85735964-85735986 AAGAAGGGAGAGAGGGAGAAAGG + Intronic
1072327174 10:94310240-94310262 AAGAAAGCAGAAAGTGGCAGTGG - Intronic
1072431084 10:95370988-95371010 GAGAAGGCAGACAGAGGCAAAGG + Intronic
1072623989 10:97099200-97099222 CAGGACGAAGAGAGGGGCCAGGG + Intronic
1072985696 10:100138069-100138091 AATAATGCAGAGAAGGGGAACGG - Intergenic
1073851526 10:107624586-107624608 AAGAATGCACAGAGAGGGAAAGG - Intergenic
1076092148 10:127695781-127695803 AAGAAGGCAGAAAGTGGAAAGGG - Intergenic
1076563847 10:131385371-131385393 AAGCACAGAGGGAGGGGCAAAGG + Intergenic
1076564149 10:131386734-131386756 AGGAGCGGAGAGAGGGGCAGAGG + Intergenic
1076848885 10:133083336-133083358 AAGCCCGCCGAGAGGGGAAATGG - Intronic
1077691218 11:4344490-4344512 ACGAACACAAAGAAGGGCAATGG - Intergenic
1078579156 11:12525496-12525518 AGAAAGGCAGAGAGGGGCAAAGG - Intronic
1079121488 11:17688289-17688311 AAGAACCCAGAGGAGGGAAAGGG + Intergenic
1079366756 11:19816467-19816489 AAGTACTCAGGGAGGGGTAACGG - Intronic
1079735269 11:23989887-23989909 AAGAAGGCAGAAAAGGGGAAGGG + Intergenic
1081416828 11:42825596-42825618 AAGAAAGCAGTCAGAGGCAAAGG + Intergenic
1081813564 11:45926616-45926638 ACCAAAGCAGAGAGGGGCAGGGG - Intronic
1083267448 11:61553362-61553384 AAGAAGGAAGAGAAGGGCGAGGG - Intronic
1084462766 11:69305300-69305322 ATGAAGGCCCAGAGGGGCAAAGG - Intronic
1085229909 11:74957677-74957699 AAGTAGACATAGAGGGGCAAGGG - Intronic
1086077441 11:82869479-82869501 AAGAAGGAAGAGAGGGAGAAAGG + Intronic
1086483115 11:87266754-87266776 AAGAAAGGATAGAGGGTCAAAGG + Intronic
1086897501 11:92330309-92330331 AATAAAGCAGAGAGGGGGATAGG - Intergenic
1088055746 11:105574475-105574497 AAAAACGCAGTGAGGAACAAAGG - Intergenic
1088754085 11:112871471-112871493 AAGAACCCAGAGGTGGGCAGAGG - Intergenic
1088996874 11:115008373-115008395 AAGGAAGGAGAGAGGGGTAATGG - Intergenic
1089115016 11:116087846-116087868 AAGAAAGGAGAGAGGGAGAAGGG - Intergenic
1090708966 11:129368785-129368807 AAGAATGAAGAGAGGGCAAAAGG - Intergenic
1092037784 12:5353876-5353898 AAGAAGGAAGAGAGGGGACAGGG + Intergenic
1092166562 12:6346306-6346328 ATGATTGCAGAGAGGGGCACAGG - Intergenic
1093483118 12:19625671-19625693 AAGAAGGGAGGGAGGGGCAAGGG - Intronic
1094214013 12:27921551-27921573 AAAGACCCAGAGTGGGGCAAGGG - Intergenic
1096054575 12:48640884-48640906 AAGAAAGCACAGAGGTGGAAAGG - Intergenic
1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG + Intronic
1098260505 12:68665273-68665295 GATAACCCAGAGAGGGGTAATGG + Exonic
1098751161 12:74294095-74294117 AACAACGCAGAAATGAGCAAGGG - Intergenic
1099321761 12:81159829-81159851 TAGAAAGAAGAGAGAGGCAAGGG - Intronic
1099837452 12:87924789-87924811 AAGCAAACAGAAAGGGGCAAAGG + Intergenic
1099982931 12:89628030-89628052 AAGAAAGCAGAAAAGGGCAGAGG + Intronic
1100396326 12:94189206-94189228 AAGAAAGGAGAGAGTGGCCAGGG + Intronic
1100542063 12:95567004-95567026 GAGAACGCAGAGAAGAGGAAGGG - Intergenic
1102542363 12:113630983-113631005 CAGAAAGCAGAGAAGGGAAAAGG - Intergenic
1103147828 12:118610829-118610851 CAGGAAGCAGAGAGGGGCCAGGG - Intergenic
1103892385 12:124249701-124249723 AAGAAAGCTGAGAGGGTCAGTGG + Intronic
1104339709 12:127936847-127936869 AGGCACCCAGAGAAGGGCAAGGG + Intergenic
1104522491 12:129488256-129488278 ATGAACCCAGAAAGGGGCATAGG - Intronic
1104873059 12:132014473-132014495 AAGACCTCGGAGAGGGTCAAAGG - Intronic
1105566794 13:21557326-21557348 AAGAACGTAAAGAAGGGAAATGG + Intronic
1106580887 13:31017270-31017292 AAGGAGGGAGAGAGAGGCAAAGG + Intergenic
1106598187 13:31164793-31164815 AAGGAGGAAGAGATGGGCAAAGG + Intergenic
1109183877 13:59246735-59246757 AAAAAAGCAGAGGGGGGCAACGG + Intergenic
1111950374 13:94704835-94704857 AAGCTTGCAGAGAGGGGCAGTGG + Intergenic
1111951570 13:94712662-94712684 GAGAACGCAGAGCGCAGCAATGG + Intergenic
1112618245 13:101027346-101027368 AAGAACACAGAGAGCAGCCATGG - Intergenic
1113016214 13:105831173-105831195 AAGAATGCAGATATGAGCAATGG + Intergenic
1113139159 13:107127876-107127898 AAGAAGGCAGAGGAGGGCCAGGG + Intergenic
1114211762 14:20621942-20621964 AACAAGGCAGAGAAGGTCAAAGG + Intergenic
1116501332 14:45626480-45626502 GAGAACGGAAAGAGGGGAAAAGG + Intergenic
1117668581 14:58082335-58082357 CAAAAGGCAGAAAGGGGCAAAGG - Intronic
1118622891 14:67630436-67630458 ATGAACAAAGAAAGGGGCAAAGG + Intronic
1119078355 14:71667556-71667578 AAGAAAGCAGATCTGGGCAAAGG - Intronic
1119844477 14:77818275-77818297 AAAAAAGCAGAGAGGGCTAAGGG - Intronic
1119938619 14:78616702-78616724 AAGAGGGCACAGATGGGCAAGGG + Intronic
1120299059 14:82682099-82682121 AAGAAACCACAGAGGGGCACAGG + Intergenic
1120419006 14:84258785-84258807 AAGAACCTAGAAAGAGGCAAGGG - Intergenic
1121955355 14:98207999-98208021 AAGAAGGGAGAGAGGGGGAGGGG + Intergenic
1122442087 14:101738930-101738952 GAGAACACAGAGAGGGGAGAGGG + Intergenic
1122619272 14:103045220-103045242 AATAACGTAGCGAGGTGCAAAGG - Intronic
1122702414 14:103598749-103598771 AAGAACTCAGGCAGGGGCAGTGG + Intronic
1202930521 14_KI270725v1_random:29596-29618 TAGAACCAAGACAGGGGCAAAGG - Intergenic
1126473958 15:49046592-49046614 GAGGAGGCAGAGAGGGGCAGTGG + Intergenic
1126802997 15:52317751-52317773 ATGAAAGGAGAGAGAGGCAAGGG + Intronic
1127697285 15:61462695-61462717 GAAAACGGAGAGAAGGGCAAAGG - Intergenic
1129017010 15:72477257-72477279 AATATCCCAAAGAGGGGCAATGG - Intronic
1129054803 15:72811410-72811432 AAGAACGTACAGAGAGGCAGTGG - Intergenic
1129263389 15:74381374-74381396 AACAAAGCAGAAAGGGGCACAGG + Intergenic
1132154922 15:99488911-99488933 AAGAATACAGAGAGGGGTAAGGG + Intergenic
1132206187 15:99987756-99987778 GAGAAGGCAGAGAGGGAAAACGG + Intronic
1133680205 16:8114116-8114138 AAGAGTGCAAAGAGAGGCAAAGG + Intergenic
1134092112 16:11397005-11397027 AATGAAGCAGAGAGGGGCCAGGG - Intronic
1135503993 16:23020523-23020545 CTGAACACAGAGAGTGGCAAAGG + Intergenic
1136504185 16:30692295-30692317 AAGCAGGTAGAGAGGGGCAGGGG - Intergenic
1136773968 16:32861263-32861285 TAGAACCAAGACAGGGGCAAAGG - Intergenic
1136896641 16:34000256-34000278 TAGAACCAAGACAGGGGCAAAGG + Intergenic
1137357907 16:47784225-47784247 AAGAAAGCAGAAATGGGTAAGGG - Intergenic
1137630605 16:49941043-49941065 AAGAAAGCGGAGTGTGGCAAAGG + Intergenic
1138162917 16:54773187-54773209 AACAAGGCAAAGAAGGGCAAAGG - Intergenic
1203076388 16_KI270728v1_random:1123374-1123396 TAGAACCAAGACAGGGGCAAAGG - Intergenic
1143122640 17:4618431-4618453 GAGAAGGCACAGAGGGGAAAGGG + Intergenic
1143735570 17:8909878-8909900 AAGAATACAGAGAGGAGCCACGG + Intronic
1143795362 17:9331776-9331798 AAAAAGGCAGAGAGGGGGGAGGG - Intronic
1145413449 17:22693959-22693981 AAGAACTCTGAGAGGAGCACAGG - Intergenic
1146668447 17:34720539-34720561 AAGAACAGAGCGAGGGGCAAGGG + Intergenic
1146768565 17:35546977-35546999 AAGAAATCAGAGATGTGCAAAGG + Intergenic
1147909981 17:43849576-43849598 AAGAAGCCAGAGAGGGCCCAGGG + Intronic
1147934263 17:44002374-44002396 AAGAAAGCAGGGAGGAGCAGGGG + Intronic
1148676547 17:49448856-49448878 CAGAATGCAGAGAGAGGCTAGGG + Intronic
1150543619 17:66129982-66130004 AAGAAGGGAAAGAGGGGGAAGGG + Intronic
1150600507 17:66646769-66646791 AAGAACTCAGAGAAGAACAAAGG + Intronic
1150713590 17:67552107-67552129 AAGACCGAAGAGATGGGGAAAGG + Intronic
1151078113 17:71297550-71297572 AAGAACAAAGGGAGGGTCAAGGG - Intergenic
1151128309 17:71869018-71869040 AAAGAAGAAGAGAGGGGCAAGGG + Intergenic
1151439389 17:74118482-74118504 AAGAAAAAAGAGAGGGGCAGGGG - Intergenic
1152100331 17:78297868-78297890 AAGAAAGAAGAGAGGGACAGAGG - Intergenic
1152359209 17:79822916-79822938 AAGAACACAGAGAGAGGCCAAGG - Intergenic
1154100183 18:11465644-11465666 AAGGAAGGAGAGAGGGGTAAGGG + Intergenic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1155035296 18:22020696-22020718 GTGAAGGCAGAGAGGAGCAAGGG - Intergenic
1155441811 18:25870113-25870135 AAGAACCCAGTGAGGGACCAAGG - Intergenic
1156040870 18:32821193-32821215 AGGGACTGAGAGAGGGGCAAGGG + Intergenic
1156370178 18:36466022-36466044 GAGAGGGCAGAGAGGGGAAAAGG - Intronic
1158569371 18:58583927-58583949 AAGAAGGCTGAGAGGCACAAGGG + Intronic
1159633956 18:70782831-70782853 AAGAAGGGAGAGAAGGGAAAAGG - Intergenic
1160615209 18:80121168-80121190 AAGGAAGCAGAGAGGGAGAAAGG - Intronic
1161438642 19:4278768-4278790 CAGAAGGAAGAGGGGGGCAAAGG - Exonic
1161829078 19:6589861-6589883 AAGAACAGAGAGAGGGACAGAGG - Intronic
1163722555 19:18905122-18905144 TGGAACGCAGGGAAGGGCAACGG + Intronic
1164997436 19:32732583-32732605 AAGAAGGCAAGGAGGGGCCACGG - Intronic
1165026287 19:32964773-32964795 AAGGTGGCAGAGAGGGGCAGGGG + Intronic
1165159690 19:33808704-33808726 AAGAAGGCAGAGAGGGGTGGGGG + Intronic
1165389138 19:35528300-35528322 AAGGATGCAGAGAGGAGCCAGGG + Exonic
1166305000 19:41932527-41932549 AAGCAGGCAGAGAGGGGCTGGGG + Intergenic
1166935748 19:46331345-46331367 AGGAAACCAGAGAGGGGCAGGGG + Intronic
1167116659 19:47492657-47492679 AAGAACCCAGAGGGAGGGAATGG - Intronic
1167464876 19:49645439-49645461 AAGAATGCAGAGAGGGGGCAGGG - Intronic
1167479265 19:49719535-49719557 AAGAACGCCAAGAAGGGCCAGGG - Intergenic
1202691571 1_KI270712v1_random:98282-98304 TAGAACCAAGACAGGGGCAAAGG + Intergenic
926122581 2:10252890-10252912 AAGGCAGCAGAGAGAGGCAAGGG - Intergenic
926772972 2:16394314-16394336 CAGAACCCAGAGAGGGGCAAGGG - Intergenic
928011108 2:27608716-27608738 AAGAAGTAAGAGAGGAGCAAAGG + Intronic
929002926 2:37366019-37366041 ACAAAGGCAGAAAGGGGCAAGGG + Intronic
930322112 2:49868665-49868687 ATGAAGGCTGAGAGAGGCAAGGG - Intergenic
930969635 2:57379207-57379229 AAGAAATTAGAGAAGGGCAAGGG - Intergenic
932471916 2:71964895-71964917 CTGAACGCAGACAGGGGCAGTGG - Intergenic
933635145 2:84700676-84700698 AAGAAGCAAGAGAGGAGCAAAGG + Intronic
933954820 2:87355668-87355690 TAGAACCAAGACAGGGGCAAAGG - Intergenic
934064611 2:88329468-88329490 AAGCAGGCAGAGAAGGGGAAGGG - Intergenic
934274177 2:91564816-91564838 TAGAACCAAGACAGGGGCAAAGG + Intergenic
934461450 2:94215236-94215258 TAGAACCAAGACAGGGGCAAAGG - Intergenic
935362138 2:102254585-102254607 AAGAACGAGGAGAGGGAGAAGGG + Intergenic
935546601 2:104406153-104406175 AAGAGCACAGAAAGGGGGAAGGG - Intergenic
937384721 2:121418459-121418481 AAGCATGCAGAGGGGGACAAGGG + Intronic
937953754 2:127408016-127408038 AAGGACGCGGAGAGGGGCAGGGG - Intergenic
939394418 2:141610474-141610496 AAGAGGTCAGAGAGTGGCAAGGG - Intronic
939568608 2:143813893-143813915 TAGAAGGAAGAGAAGGGCAAAGG + Intergenic
939642756 2:144660596-144660618 AAGAACTAAGAGAAGGTCAAAGG + Intergenic
939777047 2:146401286-146401308 AGTAAAGCAGGGAGGGGCAAGGG - Intergenic
939860954 2:147419877-147419899 AAGAAAGCAGAGAGATGCAATGG - Intergenic
940652665 2:156453233-156453255 AAGCATGAAGAGAGGAGCAAGGG + Intronic
941234573 2:162954250-162954272 AAGAACACAGAGAAATGCAATGG + Intergenic
941901078 2:170678830-170678852 AAGAACACAGAAAGGTCCAAAGG - Intergenic
943180937 2:184540317-184540339 AAGAAGGGAGAGGGGAGCAAGGG + Intergenic
943201825 2:184836852-184836874 AAGAATAGAGAGAGGGGTAAAGG - Intronic
944224855 2:197339488-197339510 CAGAGAGCAGAGAGGGACAAAGG + Intergenic
944677106 2:202042762-202042784 AAGGAACCTGAGAGGGGCAAGGG + Intergenic
944867010 2:203872173-203872195 AAGAAGGGAGAGAGGGAGAAGGG - Intronic
944965340 2:204925914-204925936 AAGAAAGGAGTGAGGAGCAAAGG - Intronic
946193865 2:218021948-218021970 AAGACCTCAGAGCGGGGGAAGGG + Intergenic
946611361 2:221461631-221461653 AACAAGGCCGAGAGGGGGAATGG + Intronic
948219583 2:236259075-236259097 GAGAACACAGAGAGGGAGAAAGG - Intronic
948873604 2:240816120-240816142 AAGAACAAAGACAGGGACAAGGG + Intronic
1170823907 20:19777197-19777219 AAGAACACAGGGAAGGGCACAGG + Intergenic
1171011984 20:21513878-21513900 AAGAAGACAGAGAGAGGCACTGG - Exonic
1171989755 20:31686823-31686845 AAAAAGGCAGAGAGAGCCAAGGG + Intronic
1172876631 20:38168303-38168325 TGAAACCCAGAGAGGGGCAAGGG - Intergenic
1172972993 20:38887031-38887053 AAGGACGAGGAGTGGGGCAAAGG + Intronic
1172994212 20:39057976-39057998 AAGAAAGCAGGGAGGGGGTATGG - Intergenic
1174496527 20:50948116-50948138 AAGACTGCAGGGAGGGGAAAAGG + Intronic
1175127968 20:56766569-56766591 TAGAAAGCAGAGAGGAGTAATGG - Intergenic
1175532530 20:59683988-59684010 AAGAACGCAGAGAGGGGCAATGG + Intronic
1175839597 20:62018676-62018698 AGGAATGCAGAGAGGAGCCAAGG + Intronic
1175866299 20:62178985-62179007 AACAACGTAGACAGGGCCAAAGG - Intronic
1176592533 21:8658192-8658214 TAGAACCAAGACAGGGGCAAAGG - Intergenic
1176866115 21:14056101-14056123 TAGAACCAAGACAGGGGCAAAGG + Intergenic
1178150995 21:29793501-29793523 GAAAAGGCAGAGAGGGGAAAAGG - Intronic
1178744454 21:35235146-35235168 AAGAACAGAGAGATGGGCAAAGG + Intronic
1179081528 21:38174943-38174965 AAGGAAGCAGAGTGGGGAAATGG - Intronic
1180275390 22:10635339-10635361 TAGAACCAAGACAGGGGCAAAGG - Intergenic
1180704493 22:17800753-17800775 ATGCAGGCACAGAGGGGCAAGGG + Intronic
1181354797 22:22291520-22291542 TAGAACCAAGACAGGGGCAAAGG + Intergenic
1182878338 22:33711611-33711633 AAGAGCACAGAGAAGGGAAAAGG + Intronic
1184221551 22:43103785-43103807 AAGAACCAAGAGAGGGACAGAGG + Intergenic
949351141 3:3126294-3126316 AAGAGCAAAGAGAGTGGCAAAGG - Intronic
949867085 3:8555145-8555167 AAGAATGCTGAGAGGGGGACGGG + Intronic
950523192 3:13508460-13508482 AAGACTGCAGAGTTGGGCAATGG + Intergenic
950523374 3:13509329-13509351 AGGCACGCAGAGAGTGGCATGGG - Intergenic
950743647 3:15069446-15069468 AAGAGGGCAGAAAAGGGCAATGG - Intergenic
951364463 3:21763910-21763932 AAGAACTGTGAGAGGGGCCAGGG + Intronic
951633905 3:24752226-24752248 AAGAAAGCAGAAATGGGCAAAGG + Intergenic
952981900 3:38742861-38742883 ATGAAGGAGGAGAGGGGCAAAGG - Intronic
956238773 3:67105883-67105905 AAGAATGGAGAGAGAAGCAAAGG - Intergenic
956462061 3:69482487-69482509 AAGAAAAGAGAGAGGGGGAATGG + Intronic
957328663 3:78730200-78730222 AAGAACCCAGAGAGAGGAAAAGG - Intronic
959466514 3:106694016-106694038 GAGAACGCAGAGAGTGTCAGGGG + Intergenic
961661611 3:128471672-128471694 TAGAGCCCAGAGAGGGGCAGGGG + Intergenic
962936473 3:140085685-140085707 AACAATGGAGAGAGGGGCAGAGG - Intronic
963907290 3:150783151-150783173 CAGAACCCAGAGAGGGGCTGAGG + Intergenic
967236123 3:187385072-187385094 AAGAACTCAGAGAGGCAAAAAGG - Intergenic
968478178 4:822259-822281 AAGAGGGCAGAGAGAGGCAGAGG - Intronic
968537501 4:1143663-1143685 AACAACTCAGAGAGGGGGACAGG - Intergenic
969392810 4:6902247-6902269 AAGAACGCGGGGAGGGGCTGCGG + Intergenic
969474103 4:7411506-7411528 AAGGAGGGAGAGAGGAGCAAAGG - Intronic
969621829 4:8282549-8282571 CAGGAGGCAGAGAGGGGCGAGGG - Intronic
970874459 4:20853373-20853395 AAAAACACAGAGTGGGGGAAAGG + Intronic
971044222 4:22787406-22787428 GGGAAGGGAGAGAGGGGCAAGGG - Intergenic
971234720 4:24830445-24830467 AAGAAAGCGGAGAGCAGCAAAGG - Intronic
972351922 4:38244090-38244112 AACACAGGAGAGAGGGGCAAAGG - Intergenic
973116942 4:46473213-46473235 ATGAAGGCAGAAAGTGGCAAAGG + Intronic
975627431 4:76363698-76363720 ATGAAGTCAGAGAGGGGCCAAGG + Intronic
975779660 4:77824879-77824901 AAGACCCCAGAAAGGGGCAGAGG - Intergenic
976449735 4:85174492-85174514 GAGGAGGCAGAGAGGAGCAAGGG - Intergenic
977084585 4:92576836-92576858 AAAAAAGCAGGGTGGGGCAACGG - Intronic
978907612 4:114026414-114026436 ATGAAAGGAGAGAGGGGTAAGGG - Intergenic
979167074 4:117547907-117547929 AAGAAGGCAGAGAGTGTCAGAGG - Intergenic
980521562 4:133942928-133942950 AGGAAGGGAGAGAGGGGGAAAGG - Intergenic
981061591 4:140431025-140431047 AAGATGGCAGAGAAGGTCAAAGG - Intergenic
981178666 4:141713844-141713866 TACAAGGAAGAGAGGGGCAAGGG - Intronic
981354686 4:143774524-143774546 AACAACCCAGGGAGGGGCAGAGG + Intergenic
981474019 4:145169999-145170021 AATAAAGCAGAGAGGGGTACAGG + Intronic
982352638 4:154432826-154432848 AAGAAAGCAGAGAGAAGAAAGGG + Intronic
984488302 4:180400756-180400778 AAGAAGGAAGAGAAGGGCAAGGG - Intergenic
986063713 5:4215693-4215715 AAGCATCCAGAGAGTGGCAATGG - Intergenic
986388034 5:7257344-7257366 AAGAACGCAGAGATGCTCAAAGG + Intergenic
987227025 5:15852862-15852884 AAGCACTCTGTGAGGGGCAATGG + Intronic
988393484 5:30666309-30666331 AAGAACCCAATGAGGGGAAAAGG - Intergenic
989358330 5:40570394-40570416 AAGGACTCAGACAGGGACAAGGG + Intergenic
989392054 5:40911375-40911397 AAGAACACAGAGAGAACCAAAGG - Intronic
991288105 5:65003352-65003374 AAAAACGAAGAGAGGAGGAAAGG - Intronic
994506201 5:100645760-100645782 AAGAACAAAGACAGGGGGAAGGG + Intergenic
995856164 5:116594485-116594507 AAGAATGTAGAGAAAGGCAAAGG - Intergenic
997581927 5:135023475-135023497 AGGAGTGCAGAGAGGGGGAAAGG + Intergenic
997818269 5:137038525-137038547 AAGAAGGCAGGGAAGGGCAAAGG + Intronic
998270129 5:140699000-140699022 AAGACAGCAAAGAGGGGCAATGG + Exonic
998613247 5:143712140-143712162 AAGGAAGCAGAGGGGAGCAATGG - Intergenic
998879203 5:146629780-146629802 AAGAAAGGAGAAAGGGGAAAGGG - Intronic
999205169 5:149842405-149842427 AAGGGAGCAGAGAGGGGCACTGG + Intronic
999596876 5:153214781-153214803 AAGCACCCAGAGTGGGGGAAGGG + Intergenic
1001324530 5:170712450-170712472 AAAGAAGCAGAGAGGGGGAATGG + Intronic
1002100644 5:176855925-176855947 AGGAACACAGCGAGGGGCCAGGG - Intronic
1002765254 6:233604-233626 AAGAAAACAGAGAGAGGCAGAGG + Intergenic
1003498905 6:6687795-6687817 AAGGAGGGAGAGGGGGGCAATGG - Intergenic
1004324689 6:14664413-14664435 AGGAAGGCAGACAGAGGCAAAGG - Intergenic
1005991099 6:30902659-30902681 AACAACCCAGAGAGGAGCAGAGG - Intergenic
1007180007 6:39923081-39923103 AAGCACTGGGAGAGGGGCAAGGG + Intronic
1007294574 6:40812204-40812226 AAGAAAGCAGAGAGGGACAGGGG + Intergenic
1007620787 6:43213305-43213327 GAGAAGGCAGAGAGAGGCTAAGG - Intronic
1007791859 6:44313754-44313776 AAGAAGGCAGAGAGTGACAGGGG + Intronic
1008461503 6:51779287-51779309 ATGAAGGCAGAGGGGGGCAGAGG - Intronic
1010890780 6:81307809-81307831 AAAAAGGATGAGAGGGGCAAGGG + Intergenic
1011442060 6:87397947-87397969 AAGAATGCAGAGAGTGGGACAGG + Exonic
1012253003 6:97000044-97000066 AAGAATGCAAAGATGGCCAATGG + Intronic
1012919778 6:105209505-105209527 AAGAAAGCAGAAAGGGGCTAAGG + Intergenic
1013207802 6:107959698-107959720 TTTAACCCAGAGAGGGGCAATGG - Intergenic
1013668627 6:112374420-112374442 AAGAATGCAGAGTGGGGCTGAGG - Intergenic
1015270177 6:131329661-131329683 AAGAAGGAAGAGAGGGAGAAAGG - Intergenic
1016365300 6:143309551-143309573 AAGAAAACAGAAAGGGGGAAGGG + Intronic
1017478787 6:154828433-154828455 AAAAAGGGAGAGAGGGACAAGGG - Intronic
1019412345 7:911840-911862 ACCCACCCAGAGAGGGGCAATGG + Intronic
1019784680 7:2967725-2967747 GAGAACTCAAAGAGGGACAATGG - Intronic
1020751861 7:12150900-12150922 AAGAAGGCAGTGAGAGGGAAAGG - Intergenic
1021510002 7:21425286-21425308 AAAAAGGGAGAGAGGGGAAAGGG - Intergenic
1022100949 7:27168865-27168887 AAGAAAGCAGGAAGGAGCAAAGG + Intronic
1022337994 7:29440711-29440733 AAGAATGCACAGAGAGGAAAAGG + Intronic
1024231510 7:47367285-47367307 CAGCAGGCAGAGAGGGGCATTGG - Intronic
1026648656 7:72195215-72195237 AAGAATGCACAGAGGAGCAAGGG - Intronic
1026976833 7:74503901-74503923 AAGCAGGGAGAGAGGGGAAAAGG - Intronic
1027593419 7:80142169-80142191 AAAAATGCAGAAATGGGCAATGG - Intronic
1029380549 7:100211611-100211633 AAGCACCCACAGAGAGGCAATGG - Intronic
1029575263 7:101399350-101399372 AAGAAAGAAGAGAGAGACAAAGG - Intronic
1030501616 7:110366570-110366592 AAGAATGAGGTGAGGGGCAATGG + Intergenic
1031713438 7:125077440-125077462 AAAAATGCAGGGAGGGGAAATGG - Intergenic
1032715675 7:134507172-134507194 CAGATGGCAGAAAGGGGCAAGGG - Intergenic
1032886281 7:136142633-136142655 AAGAAGCCAGAGAGAAGCAAGGG - Intergenic
1032948319 7:136877488-136877510 AAGAATGCAGAGAGGAGCTCTGG - Intronic
1032980252 7:137273769-137273791 AAGACCACGGAGAGGGGAAAAGG + Intronic
1033461002 7:141547406-141547428 AGGAAAGAAGAAAGGGGCAATGG + Intergenic
1034782085 7:153889601-153889623 TAAAACGCAGAGAGGGGTTAGGG - Intronic
1034842791 7:154415055-154415077 AAGCATGCAGAGATGGGCCAGGG - Intronic
1035883382 8:3267071-3267093 AAGAAGCCAGAGAGAGGGAAGGG + Intronic
1037182669 8:16026024-16026046 AGGAAAGCAGGTAGGGGCAACGG + Intergenic
1037610329 8:20470589-20470611 GAGAAAGGAGAGAGGGTCAATGG - Intergenic
1037703341 8:21295321-21295343 AAGACAGCAGAGAGGGGCCAGGG - Intergenic
1039751084 8:40479363-40479385 AAAAAAGCAGAGAAGGGTAAAGG + Intergenic
1040471063 8:47736594-47736616 AAGAACGCAGACCTGGGGAAGGG - Intergenic
1040556055 8:48478340-48478362 CAGAAGGCAAGGAGGGGCAAGGG + Intergenic
1040909181 8:52501209-52501231 AAGGACAAAGAGAGGGGGAATGG + Intergenic
1042164325 8:65930827-65930849 CAGAACGCAGAGAGGGCCCAGGG - Intergenic
1042470717 8:69184518-69184540 AAAAATACAGAAAGGGGCAAAGG + Intergenic
1046097054 8:109574998-109575020 CAGTACTCAGAGAGGGGGAACGG - Exonic
1046730067 8:117715136-117715158 AGGAGTGCAGAGAGGGGTAAGGG - Intergenic
1048445625 8:134490742-134490764 AGGAATGCAGGGAGGGGTAAAGG - Intronic
1048455147 8:134570978-134571000 AAGGAAGCAGAGAGGACCAAAGG + Intronic
1048927071 8:139280937-139280959 CAGAAGGTAGAGAGGGGCATGGG + Intergenic
1049598432 8:143495508-143495530 AAGAGGACAGAGAAGGGCAATGG + Intronic
1050607513 9:7316954-7316976 AAGGAAGCAGAGAGGTGGAAAGG + Intergenic
1051132731 9:13880818-13880840 AAGAAAGCAAAGAGGGGCAAGGG - Intergenic
1052876599 9:33572332-33572354 AAGAAAGTAGATAGGAGCAAGGG - Exonic
1053465926 9:38308544-38308566 ATGGAAGCAGAGAGGGGCCAAGG - Intergenic
1054899926 9:70358143-70358165 AAGACAGCAGAGTGGGGCAGGGG - Intergenic
1054946454 9:70801314-70801336 AGGAAACCAGGGAGGGGCAACGG - Intronic
1055751711 9:79513856-79513878 CAGAAGCAAGAGAGGGGCAAGGG + Intergenic
1056233162 9:84567384-84567406 AGGAAGGCAGAGGGGTGCAATGG - Intergenic
1056534936 9:87519106-87519128 AGGAAAGCAGACAGGGACAAAGG - Intronic
1056641992 9:88379276-88379298 AAGAACTCAGAGAGGGTTGAGGG - Intergenic
1056708936 9:88974920-88974942 AAGCATGCAGGGTGGGGCAAAGG - Intergenic
1057410204 9:94811159-94811181 GAGAACTCAGAGCGGGGGAATGG + Intronic
1057565043 9:96160061-96160083 AAGAAGGGAGAGAGGGGGAAAGG + Intergenic
1059542101 9:115141372-115141394 AAGCAGGGAGAGAGGGGCACAGG + Intergenic
1060825890 9:126687866-126687888 AGGCACGAAGAGAGGGGGAATGG + Intronic
1061050194 9:128190870-128190892 CAGAAAGCAGAGTGAGGCAAGGG + Intronic
1061181065 9:129025588-129025610 AAGAAAGGAGAGAGGGACTAAGG + Intronic
1061730067 9:132606797-132606819 AAGAAACCAGAGAGGGGCAAGGG + Intronic
1061847921 9:133398234-133398256 AAGACAGCAGAGAAGGGGAATGG + Intronic
1062201664 9:135306116-135306138 AAGAAGGGAGAGAGGGGGTAAGG - Intergenic
1203622587 Un_KI270749v1:137025-137047 TAGAACCAAGACAGGGGCAAAGG - Intergenic
1185824851 X:3240446-3240468 AAGGAAGCAAAGAGGGGGAAGGG - Intergenic
1187955209 X:24511017-24511039 AAGAAGGCACAGAGCGCCAAAGG + Intronic
1188714731 X:33447986-33448008 AAGAAGGGAGAGAGAGGAAAAGG + Intergenic
1189169867 X:38898521-38898543 AGGAAGGCAGAGAGGAGAAAGGG + Intergenic
1189699549 X:43703304-43703326 GAGCAGGTAGAGAGGGGCAAAGG - Intronic
1190467577 X:50741293-50741315 AAGAGCGGGGAAAGGGGCAATGG + Intronic
1191861716 X:65670965-65670987 AAGAAGGTAGGGAGGGGGAAAGG - Intronic
1192153828 X:68728260-68728282 TAGAACTCAGAGACGGGCACGGG + Intergenic
1192196036 X:69028891-69028913 AAGACAGCAGAGTGGTGCAATGG - Intergenic
1192409411 X:70919809-70919831 AAGAACACAAAAAGGGGAAAGGG - Intergenic
1195462075 X:105138820-105138842 AAGACAGCAGAGAGGTGGAAAGG - Intronic
1195803038 X:108734567-108734589 AAGAACTCTGGGGGGGGCAAAGG - Exonic
1195915883 X:109935082-109935104 TAGAAGGCAAAGTGGGGCAAAGG - Intergenic
1198210557 X:134512076-134512098 AAGGGCGCAGAGAGTGGCAAGGG + Intronic
1198398401 X:136246078-136246100 GAGAGCGCAGAGAGGAGAAAAGG - Exonic
1199861811 X:151807732-151807754 ATGAATGCAGGAAGGGGCAAAGG + Intergenic
1199881310 X:151975572-151975594 GAGAAGGCACAGAGGGGGAAGGG + Intergenic
1200144784 X:153920961-153920983 AAGCACGCACCTAGGGGCAAAGG - Intronic
1200180497 X:154147479-154147501 AAGGAAGCAGAGGGGAGCAATGG - Intronic
1200186325 X:154185874-154185896 AAGGAAGCAGAGGGGAGCAATGG - Intergenic
1200191977 X:154223012-154223034 AAGGAAGCAGAGGGGAGCAATGG - Intronic
1200197732 X:154260816-154260838 AAGGAAGCAGAGGGGAGCAATGG - Intronic