ID: 1175537213

View in Genome Browser
Species Human (GRCh38)
Location 20:59722924-59722946
Sequence GTGCTGGGAAAGACGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175537208_1175537213 8 Left 1175537208 20:59722893-59722915 CCACGTGCTATCAGATGGACTCC 0: 1
1: 0
2: 1
3: 3
4: 51
Right 1175537213 20:59722924-59722946 GTGCTGGGAAAGACGCCCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 151
1175537207_1175537213 9 Left 1175537207 20:59722892-59722914 CCCACGTGCTATCAGATGGACTC 0: 1
1: 0
2: 1
3: 3
4: 70
Right 1175537213 20:59722924-59722946 GTGCTGGGAAAGACGCCCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175537213 Original CRISPR GTGCTGGGAAAGACGCCCTG TGG Intronic
900117864 1:1036155-1036177 GGGGTGGGAAGGACGACCTGGGG + Intronic
900251379 1:1671969-1671991 CTGCAGAGAAAGAGGCCCTGTGG + Intronic
900987444 1:6081372-6081394 GTGCTGGGAAAGATTCAATGAGG + Intronic
901053912 1:6440039-6440061 GTGCTGGGTGGGACGCCCTCAGG + Intronic
902174806 1:14641034-14641056 CTGTTGGGAATGATGCCCTGTGG - Intronic
902331307 1:15732356-15732378 GGGCTGGGAGCTACGCCCTGGGG - Exonic
902480382 1:16708271-16708293 GTGCTGGGTGGGACGCCCTCAGG - Intergenic
902747964 1:18485701-18485723 GACCTTGGAAAGACACCCTGAGG + Exonic
903550979 1:24157249-24157271 CTGCTGGGAAAGCAGCCCTGAGG - Exonic
904405615 1:30286301-30286323 GGGCTGGGCAAGGCGCCCTGGGG + Intergenic
904458602 1:30662265-30662287 GGGCTGGGCAAGGCGCCCTGGGG + Intergenic
906322804 1:44827347-44827369 CTGCAGGGAGAAACGCCCTGGGG - Intronic
911676316 1:100662353-100662375 GTTCTGGAAAAGTGGCCCTGTGG + Intergenic
914912858 1:151801217-151801239 TCGCTGGGAATGACTCCCTGAGG - Exonic
916231817 1:162548360-162548382 GTTTTTGAAAAGACGCCCTGGGG - Intergenic
917963747 1:180165900-180165922 CTGCGGGGAAAGAAGCCTTGAGG - Intronic
919662903 1:200264737-200264759 GTGCTGGAAAGGACCCCATGGGG - Intergenic
922534854 1:226372173-226372195 GTGCTGGGGATGAAGCCCCGAGG + Intronic
922799773 1:228359913-228359935 GTGGTGGGAGACACACCCTGCGG - Intronic
924294359 1:242570474-242570496 TTGCTAGGACAGAGGCCCTGAGG + Intergenic
1069724594 10:70569060-70569082 GGGCTGGGAAAGAACCCCCGGGG - Intergenic
1069832303 10:71288839-71288861 GTGGGGGGACAGAGGCCCTGAGG - Intronic
1070850443 10:79558575-79558597 GTCCTGGGATGGAGGCCCTGGGG - Intronic
1070856776 10:79612721-79612743 GTCCTGGGATGGAGGCCCTGGGG + Intronic
1073531000 10:104232074-104232096 CTGCGGGGAAAGCCGCCCTAAGG + Intronic
1074143339 10:110696283-110696305 GTCCTGGGTAAGAAGTCCTGGGG - Intronic
1074159922 10:110829050-110829072 GTACCAGGAAAGAAGCCCTGGGG - Intronic
1074450194 10:113553167-113553189 CTGGTGGGAAAGACAGCCTGTGG + Exonic
1074549289 10:114427899-114427921 GTGCTTAGAAACACTCCCTGTGG - Intergenic
1076170288 10:128313537-128313559 GTGCTGAAAATGACTCCCTGTGG + Intergenic
1076780551 10:132721855-132721877 GTGCTGGGAGATTCACCCTGAGG + Intronic
1077899336 11:6476881-6476903 GATCTGGGAATGAAGCCCTGTGG + Exonic
1081386466 11:42478853-42478875 GTGGTTAGAAAGAGGCCCTGAGG - Intergenic
1082727002 11:56748023-56748045 GTGCTGGGAAAGTCCACTTGAGG - Intergenic
1084113084 11:67025845-67025867 GTGATGGGGAAGACGGCATGAGG + Intronic
1084793773 11:71491008-71491030 GTGCTGGGAGAGGAGCCCCGTGG - Intronic
1085802989 11:79608590-79608612 GTGTCGGCAAAGACTCCCTGAGG - Intergenic
1088826160 11:113496178-113496200 GGCCTGGGAAAGAAGCACTGGGG - Intergenic
1089871099 11:121673198-121673220 GAGCTGGGAAAGGGCCCCTGAGG + Intergenic
1090564106 11:127967915-127967937 ATGCTTGGAAAGACCCCATGTGG + Intergenic
1092521717 12:9282250-9282272 TTGCTGGGACAGAGGCTCTGTGG - Intergenic
1100429757 12:94520612-94520634 GTACTTGGAAATAAGCCCTGAGG - Intergenic
1103806307 12:123576183-123576205 GCTCTGGGAGAGACCCCCTGTGG - Intergenic
1103915625 12:124374255-124374277 GTGCTGGGAAGGAAGCCCAGAGG + Intronic
1104736484 12:131138635-131138657 GTGCGGGGAAGGACTTCCTGAGG - Intronic
1104899859 12:132183018-132183040 GGGATGGGAAAGACTCCCAGAGG - Intergenic
1118605848 14:67502797-67502819 CTGCTGGGAAATAAGCCCTGTGG - Intronic
1118846523 14:69551472-69551494 ATGCTGGGTAACAGGCCCTGAGG - Intergenic
1121846393 14:97175908-97175930 GTGCTGGGAAACATGGACTGGGG + Intergenic
1122849092 14:104517061-104517083 GTGCTGGGAAATGCCCCCTGGGG - Intronic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1125362264 15:38876590-38876612 GTGCTGGGAACCAAGACCTGTGG - Intergenic
1126067436 15:44836978-44837000 GTGATGGGAAAGAAGCCGAGGGG - Intergenic
1126092441 15:45063903-45063925 GTGATGGGAAAGAAGCCGAGGGG + Intronic
1126098157 15:45103864-45103886 GGGCTGGCAAAGAGGCTCTGTGG - Intronic
1128310812 15:66630934-66630956 GAGGTGGGACAGAAGCCCTGTGG + Intronic
1131145247 15:90006915-90006937 ACGCTGGGAAAGTCACCCTGGGG + Intronic
1142080891 16:88148259-88148281 GAGCTGGGAACGAGGCCCCGAGG - Intergenic
1142187781 16:88702610-88702632 GTGGTGGCAAAGAGGGCCTGGGG - Intronic
1147195503 17:38763850-38763872 TTTCTGGGAAAGCCTCCCTGAGG + Intronic
1147371271 17:39994741-39994763 GTGCTGGGAATGTGGCCCTTTGG - Intronic
1147386203 17:40083829-40083851 GTGCGGCGAAAGAAGCCCTGGGG - Exonic
1148808883 17:50278207-50278229 GTGCGGGGAAAGAGGCCACGTGG - Intronic
1149992245 17:61389744-61389766 GTGCAGGGAAAGCCACCCAGGGG - Intronic
1151386704 17:73759480-73759502 GTGGGAGGAAAGACGCCCGGAGG + Intergenic
1152227968 17:79101522-79101544 TGGCTGGGACAGAGGCCCTGGGG - Intronic
1152683715 17:81683560-81683582 GGGATGGGAAAGGCGACCTGGGG - Exonic
1152894175 17:82901253-82901275 GTGCTGTGACCGCCGCCCTGAGG + Intronic
1154330507 18:13425705-13425727 GTGCTGGGGTTGACGGCCTGGGG + Intronic
1155340125 18:24805345-24805367 GTGTTGGGCAAGACTCCCTCTGG - Intergenic
1162097836 19:8321411-8321433 CTGCTGGGAAAGACGCGGCGTGG + Intronic
1162542971 19:11309280-11309302 ATGCAGGGAAATAGGCCCTGTGG + Intronic
1163124558 19:15237949-15237971 GTGTGGGGAAAGACTCCCGGCGG + Exonic
1164558866 19:29274793-29274815 GGGCTGAGTAAGATGCCCTGTGG - Intergenic
1164576195 19:29406890-29406912 GAGCTGGGACAGAAGCCCAGAGG + Intergenic
1164591707 19:29511114-29511136 GGGGAGGGAAAGAAGCCCTGGGG + Intergenic
1167590607 19:50402501-50402523 CAGCTGGGAAATACGCCCTGAGG + Exonic
1167593659 19:50416900-50416922 GTGCTGGGAAAACTCCCCTGGGG - Intronic
1168555818 19:57339023-57339045 GTGCTGGGAGAAGTGCCCTGAGG + Intergenic
1202714423 1_KI270714v1_random:34173-34195 GTGCTGGGTGGGACGCCCTCAGG - Intergenic
928126541 2:28620482-28620504 GTGATGGGAGAGACGCCCCAGGG + Intronic
929246296 2:39707199-39707221 TGGCTGGGACAGACGGCCTGAGG - Intronic
934048782 2:88192743-88192765 GCCCTGGGAAAGGAGCCCTGGGG + Intergenic
934662205 2:96148974-96148996 CTGCTGGGGAAGACACTCTGAGG + Intergenic
937131825 2:119519514-119519536 GTGCTGGTTAAGAAGCTCTGCGG + Intronic
937829375 2:126403075-126403097 CTGGTGGGACAGAGGCCCTGGGG - Intergenic
939278850 2:140037066-140037088 GTACTGGGTAAGAAGACCTGTGG - Intergenic
942871235 2:180736865-180736887 GAGCTGGAAAAGATGCCCTCGGG - Intergenic
945974434 2:216259420-216259442 GTGATGGGACAGAGGGCCTGAGG + Exonic
947769062 2:232656381-232656403 GTGCTGGGAAAGTCAGTCTGTGG + Intronic
948501659 2:238398404-238398426 GTAATGGGGAAGAGGCCCTGCGG + Intronic
1172489019 20:35319304-35319326 ATGCTGGGAAAGCAGGCCTGTGG - Intronic
1173671380 20:44801426-44801448 GTGCTGGGAAATGCTCCCGGGGG - Intronic
1174334498 20:49849313-49849335 GTGGAGGGAAAGGGGCCCTGGGG + Intronic
1175120442 20:56712413-56712435 GTGCTGGGAAGGGCTCCCGGTGG - Intergenic
1175537213 20:59722924-59722946 GTGCTGGGAAAGACGCCCTGTGG + Intronic
1176124263 20:63468494-63468516 GGGGTGGGAAAGAGGCCCAGCGG + Intronic
1180825458 22:18858023-18858045 ATGCTGGGAAGGACCCTCTGGGG + Intronic
1181187274 22:21116524-21116546 ATGCTGGGAAGGACCCTCTGGGG - Intergenic
1181211924 22:21293969-21293991 ATGCTGGGAAGGACCCTCTGGGG + Intergenic
1181705543 22:24647598-24647620 ATGCTGGGAAGGACCCTCTGGGG - Intergenic
1183518809 22:38284229-38284251 GCTCTGGGAAAGAGGCCATGGGG + Intergenic
1185318353 22:50188788-50188810 GTCCTGGGACAGAAGCCCTGCGG + Intronic
1185335190 22:50268126-50268148 TTGCTGGGAAGGAGCCCCTGGGG + Intronic
1203215030 22_KI270731v1_random:1463-1485 ATGCTGGGAAGGACCCTCTGGGG - Intergenic
1203275606 22_KI270734v1_random:83926-83948 ATGCTGGGAAGGACCCTCTGGGG + Intergenic
950334281 3:12181285-12181307 GTACTGGGCATGAGGCCCTGGGG + Intronic
959159366 3:102705221-102705243 GTGCTGAGGAAGAGGCCCTGTGG - Intergenic
961014202 3:123454876-123454898 GGGCTGAGAAAGAAACCCTGTGG + Intergenic
961380204 3:126492083-126492105 GTGGTGGGAAGGAGGGCCTGGGG - Intronic
961382966 3:126508004-126508026 CTGCTGGGAAAGAGGCCAAGTGG + Exonic
966910143 3:184555089-184555111 GTTCTGGGAAAGAAACCCAGGGG + Intronic
969232316 4:5840264-5840286 GTGCTCGGGAAGCCGCCCTCCGG - Intronic
970415846 4:15856178-15856200 TTGGAGGGAAAGATGCCCTGTGG + Intergenic
970593972 4:17583381-17583403 GTGCTGAGAAAACAGCCCTGGGG - Intronic
984605983 4:181786749-181786771 GTGCTGGGAGCGACTCCCTATGG - Intergenic
986125107 5:4877143-4877165 GTGGTGGGAAGGATGCCCAGGGG - Intergenic
986352849 5:6896082-6896104 CAGCTGGGAAAGACCCCCTAGGG - Intergenic
991604642 5:68388585-68388607 GTCCTGGGAAAGCATCCCTGGGG + Intergenic
992774520 5:80077896-80077918 GTGTTGGGAGAGGAGCCCTGGGG - Intronic
997528909 5:134570333-134570355 GGGCTGGAAAAGAGCCCCTGTGG - Intronic
997673739 5:135696884-135696906 GGGCTGGGAAAGGGCCCCTGGGG + Intergenic
999772209 5:154784230-154784252 CTGCTGTGAAAGCAGCCCTGTGG + Intronic
1002103660 5:176869474-176869496 GAGCTGGGAGAGAAGGCCTGGGG - Intronic
1003555883 6:7140147-7140169 AAGCTGGCAAAGACGCCGTGTGG - Intronic
1004177322 6:13351071-13351093 GTGCTGGGAGAGCCTGCCTGTGG + Intergenic
1007091389 6:39186972-39186994 CTGCTGGGAATGGAGCCCTGGGG + Intergenic
1007414834 6:41685141-41685163 GTGCTGTGATAGAGGCCCAGGGG - Intronic
1007978954 6:46130423-46130445 GTGCTGGGGAAGGCAACCTGTGG + Intronic
1008195172 6:48510033-48510055 CTGCTGGGAAACTCTCCCTGTGG + Intergenic
1011519982 6:88194548-88194570 GTGCTGGGGAGTAAGCCCTGGGG + Intergenic
1013161634 6:107550620-107550642 GGGCTGGGTAAGTCACCCTGTGG - Intronic
1013614955 6:111834404-111834426 GTACTGGGAAGGAGGCACTGAGG - Intronic
1014981228 6:127948557-127948579 GTGTTGGGAAAGATGCCATATGG + Intergenic
1016314923 6:142774401-142774423 GTGCTGTGCATGACCCCCTGTGG + Exonic
1017827919 6:158096008-158096030 GTGCTGAGAAAGTCCCCTTGTGG - Exonic
1018927709 6:168217803-168217825 GTGATGGGAAAGGCAGCCTGAGG - Intergenic
1019265652 7:116194-116216 GTTATGGGAAAGAGCCCCTGTGG - Intergenic
1023033170 7:36108550-36108572 CTGCTGGGAAACAAGGCCTGAGG - Intergenic
1025033131 7:55572892-55572914 GTGATGGGAAGGCCGGCCTGGGG + Intronic
1029365767 7:100115186-100115208 GTGGTGGGATTGAAGCCCTGAGG - Intronic
1030537622 7:110789023-110789045 TTGCCTGGAAAGACGACCTGGGG + Intronic
1031999093 7:128253172-128253194 GAGATGGGATAGAGGCCCTGAGG - Intronic
1032990999 7:137395142-137395164 GAGCTGGGAAAGAATCCCTTTGG + Intronic
1034430421 7:151038574-151038596 GTGGTGGGACAGTCTCCCTGTGG + Intronic
1035239821 7:157522271-157522293 GCGCTCAGAAAGACGCCCTCAGG + Intergenic
1035286860 7:157812262-157812284 TTGCCGGGAGAGACGCCCAGAGG + Intronic
1036224428 8:6945585-6945607 GTGCTGGGAAAGACGGACAAAGG - Intergenic
1039880647 8:41623413-41623435 GAGCTGGGAATGACACCCAGTGG + Exonic
1043149752 8:76700273-76700295 GTGCTGGGAAAGAAGACCAGTGG - Intronic
1046737114 8:117789095-117789117 TTGCTGAGATAGATGCCCTGAGG - Intergenic
1048860724 8:138722860-138722882 GTGGTGGAAAACACACCCTGGGG + Intronic
1048896890 8:139000411-139000433 GGGCTGGGAAACACGCCCACTGG + Intergenic
1049188089 8:141269945-141269967 GTGCGGGGAAAGACATGCTGGGG - Intronic
1049283702 8:141763309-141763331 GTGCCGGGAAAGGCGGCTTGCGG - Intergenic
1049463059 8:142738990-142739012 GGGCGGGGAGGGACGCCCTGCGG + Intergenic
1049539429 8:143201058-143201080 GTCCTGGGAAAGTGGTCCTGAGG - Intergenic
1052973050 9:34389643-34389665 GTGCTGAGAACCACGCCCGGTGG + Intronic
1058992882 9:110271386-110271408 GTGCTTGGAGAGATGACCTGAGG - Intergenic
1059008138 9:110426741-110426763 GTGAAGGGAAAGACTCCCTTTGG - Intronic
1059337388 9:113577762-113577784 GTGTTGGGAAGGCCGCCCTGTGG - Intronic
1059734969 9:117091659-117091681 GTGCTGGGGAAGAGGCCCCGGGG + Intronic
1186159278 X:6759727-6759749 GAGCTGGGGAACACGTCCTGAGG - Intergenic
1189464200 X:41265888-41265910 GTGCTGGCAATGGTGCCCTGTGG + Intergenic
1192207776 X:69107538-69107560 TGGCTGGGAAAGGGGCCCTGTGG - Intergenic