ID: 1175538393

View in Genome Browser
Species Human (GRCh38)
Location 20:59731788-59731810
Sequence TAGAAGAAGCTTAATGACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175538393 Original CRISPR TAGAAGAAGCTTAATGACTT GGG Intronic
901582468 1:10256279-10256301 TAGTCGAAGCTGAAGGACTTTGG - Exonic
905333915 1:37230638-37230660 GAGAAAAAGCTTTATGACATTGG - Intergenic
907211997 1:52831846-52831868 TAACAAAAGCTTAAGGACTTAGG + Intergenic
911149579 1:94584344-94584366 TAGAAAAAGATAAATGACCTGGG + Intergenic
911397349 1:97327664-97327686 TTAAAGAAGCTTAGTGACATAGG - Intronic
912090382 1:106066120-106066142 GGGAAAAAGCTTCATGACTTTGG + Intergenic
912540980 1:110415162-110415184 TAGAAGAAGCTCAATAAATGTGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
918800334 1:188962191-188962213 AAGAAGAAGCTGAATGGATTTGG - Intergenic
921368254 1:214395486-214395508 TAGAATAAACTTTTTGACTTTGG + Intronic
924891571 1:248287390-248287412 AAGAAAAATCTTTATGACTTGGG + Intergenic
1063082354 10:2780374-2780396 TAGAAGAAACTGAATGACCCAGG - Intergenic
1065388036 10:25153196-25153218 TGGCAGAATCTTTATGACTTTGG - Intergenic
1065965190 10:30765194-30765216 TAGAGGAAGATAAATGGCTTAGG - Intergenic
1065986644 10:30960351-30960373 TAGAAGAAACTTTATGACCTTGG - Intronic
1066036625 10:31494977-31494999 AAGAAAAAGCATAATGCCTTAGG + Intronic
1068832632 10:61514865-61514887 TAGAATAAGTTCTATGACTTTGG + Intergenic
1072590911 10:96827712-96827734 TAGAACAAGCTTAGTGGCATGGG + Intergenic
1073276315 10:102314718-102314740 TAGCAGAAGCATAATTTCTTTGG + Intronic
1074632721 10:115275823-115275845 TAGAAGACATTTAATGGCTTAGG - Intronic
1075386929 10:122061770-122061792 TAGAACAAGCTAAATGCCCTAGG + Intronic
1078122645 11:8525655-8525677 TAGAAGATGCTTTATGACCCTGG + Intronic
1078861460 11:15251148-15251170 TGGAAGAAGCAAAATGAGTTTGG + Intergenic
1079200537 11:18373686-18373708 AAAAAAAAGCTTATTGACTTAGG + Intergenic
1079390229 11:20015827-20015849 TAGAAGGAGCTGAAGGACTGTGG + Intronic
1081340302 11:41919371-41919393 TAGAAGAAGAAAAATGATTTAGG - Intergenic
1082013275 11:47465482-47465504 AAGTAGAAGCTTAAGAACTTTGG + Intergenic
1082707509 11:56510682-56510704 TAGAAGAAGCTTCATGACACTGG - Intergenic
1083381745 11:62274825-62274847 TAGAAGCAGCTTGGTGAGTTGGG + Intergenic
1084348437 11:68574789-68574811 TAGAAGAAGGCTCATGGCTTGGG - Intronic
1084632846 11:70366456-70366478 AAGAAGAGGCTTAATTCCTTAGG - Intronic
1092082562 12:5729046-5729068 TAGAAATATCTTAATGACATTGG + Intronic
1092669808 12:10850048-10850070 TAGGAGAATCTTAATCTCTTTGG - Intronic
1093347723 12:18060163-18060185 TAGAAGTATTTTAAAGACTTAGG - Intergenic
1093466095 12:19451260-19451282 TGGAAGCAGCTTAAAGACTGGGG + Intronic
1093870615 12:24286779-24286801 TAAAGGAAGCCAAATGACTTAGG + Intergenic
1095717322 12:45360685-45360707 TAAAAAAAACTTTATGACTTTGG - Intronic
1097459965 12:59849554-59849576 ATGAAGAAGCTTAATGCCCTTGG + Intergenic
1098231613 12:68376955-68376977 TAAAAATAGCTTAATGACATAGG - Intergenic
1098968081 12:76815961-76815983 CAGAAGAAGGCTAATGACTGTGG - Exonic
1100239572 12:92697866-92697888 CAAAAGAAATTTAATGACTTGGG + Intergenic
1102806342 12:115784026-115784048 TAGAAGATGCTTAATGTTATCGG - Intergenic
1105275662 13:18922004-18922026 CAGAAGATGCTTACTGACCTTGG + Intergenic
1107216521 13:37926638-37926660 CATAAGAAGTTTAATAACTTAGG - Intergenic
1107523566 13:41207090-41207112 TAGAAGAAGGATAATTACCTGGG - Intergenic
1110033698 13:70652904-70652926 TACAAGAAGCCTAAAGGCTTTGG - Intergenic
1111580634 13:90218823-90218845 AAGAAGAAGATTTATGTCTTTGG + Intergenic
1111813900 13:93126051-93126073 AAGAACAAGCTAAATTACTTTGG - Intergenic
1114335399 14:21684297-21684319 TAGAAGAGGCTAAATAACTGAGG - Intergenic
1115930665 14:38489317-38489339 TAGAAAAAGCTTAAAGACTAAGG - Intergenic
1119047378 14:71330982-71331004 AAGAAAAAGCTTCATTACTTTGG - Intronic
1119496943 14:75088044-75088066 TAGAAAAAGTTTCATGACCTTGG + Intronic
1119959916 14:78843384-78843406 TACAATAGGCTTAATGACTTTGG + Intronic
1121913416 14:97813628-97813650 TAGAAGTAGATCAATGAATTTGG + Intergenic
1123139425 14:106061033-106061055 TAGAACACTCTTCATGACTTAGG - Intergenic
1123959765 15:25385018-25385040 GAGAAAAAGCTTCATGACATTGG + Intronic
1124835624 15:33194112-33194134 CAGAAGCAGCTTCATGACTATGG - Intronic
1125146706 15:36478454-36478476 TAGAAAAAGGATAATGACTTTGG + Intergenic
1125276363 15:37996224-37996246 TAGAGGGAGCTGAGTGACTTGGG + Intergenic
1127137358 15:55938519-55938541 GAGAAGAAGCTTCTTGACTTTGG + Intronic
1127917095 15:63463799-63463821 TAGAAGAATCCTAAAGACTGGGG - Intergenic
1129883179 15:79020289-79020311 TATAAGAAGCTCAATGAAGTGGG + Intronic
1132161455 15:99546955-99546977 CAGAAGAAGCTTTAGGACCTGGG - Intergenic
1133496924 16:6327432-6327454 TAGAAGCATCTTTATGACTTTGG + Intronic
1134570813 16:15289607-15289629 TATAAGAAGCTCTGTGACTTTGG - Intergenic
1134731565 16:16466467-16466489 TATAAGAAGCTCTGTGACTTTGG + Intergenic
1134935885 16:18245534-18245556 TATAAGAAGCTCTGTGACTTTGG - Intergenic
1135066357 16:19313563-19313585 TACAAGAAGCTTCCTAACTTGGG - Intronic
1135573157 16:23564903-23564925 TAGAAGAAGCTCAATATGTTGGG + Intronic
1136870105 16:33799078-33799100 TAGAACAATCTTCGTGACTTAGG + Intergenic
1138403026 16:56764165-56764187 AAGAAGAAACTAAATGATTTTGG + Intronic
1139092447 16:63664890-63664912 TAGAAAACCTTTAATGACTTTGG + Intergenic
1141366318 16:83446822-83446844 AAGGATAAGCTTAAAGACTTTGG - Intronic
1203102066 16_KI270728v1_random:1316976-1316998 TAGAACAATCTTCGTGACTTAGG - Intergenic
1146561720 17:33875692-33875714 AAGAAGATGCTTAATGAATATGG + Intronic
1146740817 17:35282151-35282173 TAGAAGGAGCTCAAAGACTCAGG + Intergenic
1148886695 17:50778637-50778659 TACAAGAAGCTTCAGGACTGAGG + Intergenic
1151127462 17:71860444-71860466 TAGACGCTGCTTAATGATTTTGG - Intergenic
1153548003 18:6229555-6229577 GAGAAAAAGCTTCATGACATTGG - Intronic
1154467284 18:14659139-14659161 CAGAAGATGCTTACTGACCTTGG + Intergenic
1155831402 18:30519270-30519292 GTGAAAAAGCATAATGACTTTGG + Intergenic
1156223869 18:35082394-35082416 AAGAAGAAGCTTAACTAATTTGG - Intronic
1156833585 18:41525476-41525498 CAGAAGAGGCTTAACCACTTTGG - Intergenic
1156835757 18:41552426-41552448 GAGAAGAAGGTTAAAGACTTGGG + Intergenic
1157459806 18:47880222-47880244 TAGGAGAATATTTATGACTTGGG - Intronic
1158057752 18:53302184-53302206 TAGAAGAATCTGACTGAATTTGG - Intronic
1162874786 19:13612942-13612964 TAAAAGCAGCTTAAACACTTTGG + Intronic
1166424569 19:42665102-42665124 GAAAAGAAGCTTCATGACATTGG - Intronic
925021180 2:569409-569431 TAGAAGAAGCTCAATGCTCTAGG - Intergenic
926248157 2:11136207-11136229 AGGAAGAAGCTTCATGACATTGG - Intronic
926561476 2:14422307-14422329 TGGAAGAAGCCTAATAACTGAGG - Intergenic
926961568 2:18363748-18363770 TAGAAGAAGCTGAATGAAAGGGG + Intergenic
927277957 2:21277803-21277825 TATAAGAATGTTAATGACATGGG + Intergenic
928826528 2:35428330-35428352 TAAGAGAATTTTAATGACTTGGG + Intergenic
930108549 2:47658635-47658657 TAGAGGAAAGTAAATGACTTGGG + Intergenic
930528437 2:52561287-52561309 TAGTAAAAGCTTAATTACCTAGG - Intergenic
933834569 2:86234929-86234951 TAGAAGAAATTTGATGACTAAGG + Intronic
935829405 2:106985007-106985029 TAGAACAAGCAAAATGACATGGG + Intergenic
937825328 2:126362731-126362753 TAGCAGATGCTGAATGTCTTAGG - Intergenic
938700010 2:133868000-133868022 AAGAAAAAGCTTCATTACTTTGG + Intergenic
939421516 2:141976801-141976823 TAGGAGAAGCTCAAGGACCTGGG + Intronic
941107240 2:161369300-161369322 TAGAAAAAGTTTACTGACTCTGG - Intronic
941324702 2:164099339-164099361 GAGAAGAAGCTTAGAGACTCAGG - Intergenic
941522648 2:166566556-166566578 TAGGAAAAGCTTTATGACATTGG + Intergenic
944134795 2:196387214-196387236 TAGAATATGCTTAAGTACTTTGG + Intronic
945751080 2:213783327-213783349 AAAAAAAATCTTAATGACTTAGG + Intronic
948618851 2:239220679-239220701 TAGATGAAGCTGAATGACTAAGG - Intronic
1170071026 20:12368431-12368453 TAAAGGAAGCATAATGAATTTGG + Intergenic
1172299022 20:33835335-33835357 TACAAGAAGCTCAATGACCCTGG - Intronic
1174598406 20:51703443-51703465 TAGAAGACTTTTAATGATTTAGG - Intronic
1174829325 20:53798125-53798147 GAAAAGAAGCTTATTGACCTAGG - Intergenic
1175538393 20:59731788-59731810 TAGAAGAAGCTTAATGACTTGGG + Intronic
1175621099 20:60448313-60448335 TGGAAGAAGCATAAAGAATTTGG - Intergenic
1176807227 21:13498540-13498562 CAGAAGATGCTTACTGACCTTGG - Intergenic
1177886768 21:26756734-26756756 TAGTGGAAGCTTGATGACATTGG - Intergenic
1178974738 21:37210991-37211013 AAGAATAATCTTATTGACTTTGG - Intergenic
1181877048 22:25947848-25947870 TGGAAGAAGCTCAGGGACTTGGG + Intronic
956688184 3:71851716-71851738 TTCAAGAAGCTTAAGTACTTTGG + Intergenic
957478101 3:80753377-80753399 TTTAAAAAGTTTAATGACTTGGG - Intergenic
957684240 3:83479943-83479965 TAGATGAAGCTTATGGATTTAGG + Intergenic
957739452 3:84245627-84245649 CAGAATAAGCTTAATCACTAAGG - Intergenic
958535173 3:95392585-95392607 TAAAAATATCTTAATGACTTTGG + Intergenic
959403644 3:105933844-105933866 CAGAGGAAGGTTAAGGACTTGGG + Intergenic
959653580 3:108775633-108775655 AAAAAGAACCTTAAAGACTTAGG + Intergenic
959706093 3:109340077-109340099 CAGATGCAGATTAATGACTTTGG - Intergenic
960773014 3:121216039-121216061 GAGAAGAAGATAAATGACCTTGG - Intronic
961232744 3:125333451-125333473 TAGATGATGCTAAATGAATTAGG - Intronic
961838262 3:129683139-129683161 TAGAAGCTGCTTAAAAACTTTGG - Intronic
962667330 3:137668173-137668195 TAGAAGTATCTTTATGACCTTGG - Intergenic
962819196 3:139031128-139031150 GAGAAAAAGCTTCATGACATTGG - Intronic
962960561 3:140307550-140307572 CTGAAAAATCTTAATGACTTTGG + Intronic
964193535 3:154034223-154034245 GAGAGGTAGCTTAATGACATCGG - Intergenic
964247360 3:154669161-154669183 TAGAAGAAGCCTAATTCTTTAGG + Intergenic
964348585 3:155780505-155780527 TAAAAGAAGATTATTGAGTTTGG - Intronic
965274252 3:166660414-166660436 TAGAAAAAGCTTCTTGACATTGG + Intergenic
966139781 3:176743322-176743344 TAGGAGAATCTTCATGACCTGGG - Intergenic
966552461 3:181220382-181220404 AAGAAGAATCTTAATTATTTAGG + Intergenic
966727283 3:183119005-183119027 TAGTCGAAGCTTTATGCCTTTGG + Intergenic
967143271 3:186582449-186582471 TAAAAAAAGCTTTAAGACTTAGG + Intronic
970583694 4:17495327-17495349 TAGAAGAGGCTCCATGACATGGG - Intronic
970656779 4:18239904-18239926 TACCAGAAGCTTCTTGACTTGGG - Intergenic
970956785 4:21821821-21821843 TATAAGAGGCTTAATGAATAGGG - Intronic
972041994 4:34613956-34613978 TAAAAGAATTTTACTGACTTGGG - Intergenic
972633123 4:40858918-40858940 TAGAAGAGGGTTTAAGACTTGGG + Intronic
973760820 4:54113936-54113958 GGGAAGAAGCTTTATGACATTGG - Intronic
974322780 4:60373391-60373413 TGGAAGAAGCTTCATGAAATTGG - Intergenic
975406953 4:74000566-74000588 TAAAAGAAGTTTAATTACATAGG + Intergenic
975642013 4:76510409-76510431 CAGATGTAGCTGAATGACTTTGG + Intronic
975705387 4:77107180-77107202 TAGAGGAAACTCCATGACTTTGG + Intergenic
976264175 4:83174560-83174582 GAGAAGAAGCTTAATAAATTAGG - Intergenic
976940339 4:90693557-90693579 TGGAATAAGCTTGATGACCTTGG + Intronic
977264068 4:94833454-94833476 TAAAAGGAGCTTAATGAATCAGG - Intronic
977354136 4:95924492-95924514 TAGAAGAATTTTAAAGCCTTAGG + Intergenic
978085730 4:104650499-104650521 GAGAAGAAGCTTTATGAAATTGG + Intergenic
978690793 4:111506870-111506892 TAGAAGTAGCTTTGTAACTTGGG - Intergenic
979216208 4:118167350-118167372 TACAAGTTGCTTACTGACTTGGG - Intronic
980649362 4:135690188-135690210 TAGAAGAGGCTTGAAGAATTTGG + Intergenic
982339053 4:154274673-154274695 TAGTAGATGCTTAATGAGTACGG + Intronic
982506577 4:156226374-156226396 TAAAAGATGATTAATTACTTTGG + Intergenic
982530202 4:156531748-156531770 TGGATGAAGCTCATTGACTTTGG - Intergenic
982647318 4:158040025-158040047 TAGAAGAAGTTTCATGAATCAGG - Intergenic
984020479 4:174478999-174479021 TAGAAGAAAATGAATAACTTGGG + Intergenic
986550113 5:8944030-8944052 AAGAAGAAACTTAATAATTTAGG - Intergenic
988555244 5:32230894-32230916 TAAAAGAATCTTTATGACTTCGG - Intronic
990031381 5:51263608-51263630 GAGAAAAAGCTTGATGACATTGG - Intergenic
990927516 5:61044426-61044448 AAGAAAAAGCTTATTGGCTTTGG - Intronic
992512564 5:77453069-77453091 TATCAGAAACATAATGACTTAGG - Intronic
992588117 5:78262302-78262324 GAGAAAAAGCTTCATGACATTGG - Intronic
994349568 5:98728993-98729015 TAGAAAAAGCTTAAGGCCCTTGG - Intergenic
994366866 5:98927928-98927950 TTGAAGAGGTTTAATAACTTAGG - Intronic
994539090 5:101071848-101071870 TAGAAGAACCTTAATTAATAAGG + Intergenic
996363499 5:122676293-122676315 GAGAAAAAGCATAAGGACTTGGG - Intergenic
999054126 5:148555464-148555486 TAGAAGAAGCTTTTTAAATTAGG + Intronic
1000453334 5:161418257-161418279 CAGAAGAAGAATAATGACTGAGG - Intronic
1000571412 5:162918740-162918762 AAGAAGAAGCTATATGACATTGG - Intergenic
1000602684 5:163293918-163293940 TATAAGATGCTTAATAAATTCGG + Intergenic
1000818741 5:165957449-165957471 TAGATGAATCATAATGGCTTGGG - Intergenic
1001169359 5:169404158-169404180 CAGAAGAAACTTAATCACTGTGG - Intergenic
1002864928 6:1113003-1113025 GAGAAAAAGCTTCCTGACTTTGG + Intergenic
1002971603 6:2028340-2028362 TTGCAGAAGCTAAATGATTTAGG - Intronic
1006470571 6:34226527-34226549 TCGAAGCAGCTTCTTGACTTGGG - Intergenic
1010080766 6:71858683-71858705 TCGAAAAATCTTAGTGACTTTGG - Intergenic
1010083756 6:71891793-71891815 TAATAGAAGCATAATGTCTTGGG + Intronic
1015300247 6:131644792-131644814 TAGAACAACCTTAAAGAATTGGG + Intronic
1015397643 6:132753018-132753040 TAAAAAAAGCTTACGGACTTTGG - Intronic
1016719078 6:147272333-147272355 AAGAATAAGTTTTATGACTTAGG - Intronic
1017001066 6:149998004-149998026 TCAAAGAACCTTATTGACTTTGG - Intergenic
1019265254 7:112142-112164 CAGAAGAATTTTTATGACTTGGG - Intergenic
1020437384 7:8179316-8179338 AAGAAGAGGCTAAATGACTTAGG + Intronic
1021533676 7:21678149-21678171 TGGGAAAAGCTTCATGACTTTGG - Intronic
1021536113 7:21706648-21706670 TAGAAGAAAGTAAATGCCTTAGG - Intronic
1022233389 7:28436995-28437017 AAGAAGCAGCTGAATGTCTTTGG + Intronic
1023092613 7:36631048-36631070 TAGAAGTAGCTTAATGGGATGGG + Intronic
1023687747 7:42753868-42753890 TGAAAGAATCTGAATGACTTTGG - Intergenic
1025021677 7:55485350-55485372 TAGAAGACTTCTAATGACTTGGG - Intronic
1026552427 7:71379905-71379927 AAGAAGGAGCTTAAGGATTTGGG + Intronic
1027151268 7:75735498-75735520 TAGAAAAAATTTAATGAGTTAGG - Intronic
1027585460 7:80052517-80052539 CTGAAGAATATTAATGACTTTGG - Intergenic
1027874816 7:83755399-83755421 TAAAAGAAGGTTGATGATTTGGG + Intergenic
1027932779 7:84560545-84560567 GAGAATAAGCTTCATGACATTGG + Intergenic
1028167426 7:87553896-87553918 TAGAAGAAGCTAAAAGAATTGGG - Exonic
1029931463 7:104375680-104375702 TAGAAAAAAATTAATGAATTTGG + Intronic
1031659593 7:124405171-124405193 TCGAAGAAGCATAATGTTTTAGG + Intergenic
1031928231 7:127658423-127658445 TAGAAGAAAAATAGTGACTTTGG - Intronic
1032304152 7:130716814-130716836 TACAAGACACTTACTGACTTGGG - Intergenic
1034838868 7:154377174-154377196 TAAATGAAGCTTAATCACTCTGG - Intronic
1035817376 8:2555888-2555910 AAGAAAAAGCTTCATGACATTGG + Intergenic
1035901289 8:3460846-3460868 TAGAACAAGCTTCCTGACCTGGG - Intronic
1037199507 8:16234892-16234914 TACAAGAAGCGGAATGACTGAGG - Intronic
1038110019 8:24485834-24485856 TACTAGAAGCTTAGAGACTTTGG - Intronic
1039266532 8:35830659-35830681 TAGAGGAAACTTAATGGATTTGG + Intergenic
1040712141 8:50201846-50201868 AAGAAGAAGCTAAATGATTCAGG - Intronic
1041213968 8:55581483-55581505 TGGAAGAAAATTAATGACTGAGG + Intergenic
1042670320 8:71255644-71255666 TAGGAAAAGCTTCATGACATTGG + Intronic
1042838238 8:73097170-73097192 TAAAAGGAGCTAAATGACCTGGG + Intronic
1042978443 8:74498159-74498181 AAGAAGAATCAAAATGACTTAGG - Intergenic
1043338750 8:79210690-79210712 AAGAAGAAGCTTCATGCCTCAGG - Intergenic
1044051358 8:87509766-87509788 CAGAAGAAGATTGATGTCTTGGG - Intronic
1047104095 8:121714119-121714141 TAGAAGATGGTGAATAACTTAGG - Intergenic
1047196707 8:122728331-122728353 TAAAAGACGCTCTATGACTTTGG - Intergenic
1048872264 8:138809360-138809382 TAGCAGATGCTTAATGTCTATGG + Intronic
1049093956 8:140536895-140536917 TAAAAGAAGCCTAAAGACATAGG - Intronic
1050965311 9:11794312-11794334 TTGAGGAAGCTTGATGACTTTGG - Intergenic
1050993242 9:12179183-12179205 TAGAAGTAATTTAATTACTTAGG + Intergenic
1051557398 9:18400131-18400153 AAGAAAAAACTTAATGGCTTTGG - Intergenic
1056199021 9:84256640-84256662 AAGAACAAGCTTAATAACTGAGG + Intergenic
1057242631 9:93425242-93425264 GAGAAAAAGCTTCATGACATGGG - Intergenic
1058255445 9:102756670-102756692 TAAGAGAAGCTCAATGATTTGGG + Intergenic
1060307317 9:122426244-122426266 TAGAAGAACCTAAATAACTTTGG - Intergenic
1186996938 X:15133500-15133522 TAGATGAAGCCTAATGATTGAGG + Intergenic
1188377496 X:29450039-29450061 TATTACAATCTTAATGACTTGGG + Intronic
1188408147 X:29837718-29837740 TACAAGAAGCTAAAGGTCTTTGG + Intronic
1190922252 X:54865079-54865101 AAGAAAAAGCTTCATGACATTGG - Intergenic
1193920727 X:87422773-87422795 TAGAAGAAAGTTTATGACATTGG - Intergenic
1195491803 X:105479214-105479236 AAGAAGAAGCTGCTTGACTTTGG + Intronic
1196088848 X:111716885-111716907 TGGAAGAACCTTAATCACTAGGG + Intronic
1196109974 X:111936266-111936288 TACAGAAAGGTTAATGACTTTGG + Intronic
1197632151 X:128873717-128873739 TAGGAGAAGCTGGATGATTTTGG - Intergenic
1199210401 X:145202491-145202513 GAGAAAAAGCTTCTTGACTTTGG + Intergenic
1201520801 Y:14871430-14871452 AAGAAGATGTTTAATGACATTGG + Intergenic