ID: 1175539710

View in Genome Browser
Species Human (GRCh38)
Location 20:59740911-59740933
Sequence AGGCCGTCCTGGGCCTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 221}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175539705_1175539710 -9 Left 1175539705 20:59740897-59740919 CCCAGATTCAGAGCAGGCCGTCC 0: 1
1: 0
2: 1
3: 9
4: 98
Right 1175539710 20:59740911-59740933 AGGCCGTCCTGGGCCTCCTTGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1175539706_1175539710 -10 Left 1175539706 20:59740898-59740920 CCAGATTCAGAGCAGGCCGTCCT 0: 1
1: 0
2: 3
3: 10
4: 120
Right 1175539710 20:59740911-59740933 AGGCCGTCCTGGGCCTCCTTGGG 0: 1
1: 0
2: 2
3: 32
4: 221
1175539703_1175539710 27 Left 1175539703 20:59740861-59740883 CCTCATATGGCTCTTCTCAGGCT 0: 1
1: 0
2: 3
3: 12
4: 210
Right 1175539710 20:59740911-59740933 AGGCCGTCCTGGGCCTCCTTGGG 0: 1
1: 0
2: 2
3: 32
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175539710 Original CRISPR AGGCCGTCCTGGGCCTCCTT GGG Intronic
900743683 1:4345700-4345722 AGGCCGTCCTTGGCCCTCTTTGG + Intergenic
902196386 1:14801581-14801603 AGGCCGTCATAGCCCTCCTGAGG - Intronic
904317291 1:29673720-29673742 TGGCCCTCCTGGGCATCCTGGGG + Intergenic
904405034 1:30282772-30282794 AAGCCATCCTGGGCCTCATGTGG - Intergenic
905696819 1:39980728-39980750 AGGCAGGGCTGGGCCTCTTTAGG - Intergenic
910109266 1:83665011-83665033 AGGCCATCCTGGGCCACATGTGG - Intergenic
910203609 1:84725225-84725247 AAGCCATCCTGGGCCTCCTGTGG - Intergenic
910289051 1:85582161-85582183 AGGCCGTCCTGGTCCTCCATGGG - Exonic
912584495 1:110750097-110750119 AGCCAGTTCTGGGCTTCCTTTGG - Intergenic
912861164 1:113215142-113215164 AGGACGACCTGGGCAGCCTTGGG - Intergenic
917121930 1:171652262-171652284 AGCCCCTCCTGGGTCTCCTGGGG + Exonic
917265275 1:173214655-173214677 AAGCCGTCCTGGGCCACATGTGG + Intergenic
919005249 1:191890783-191890805 AAGCTGTCCTGGGCCACATTGGG + Intergenic
1062931335 10:1354641-1354663 GGGCCCTCCTGGGCATCCTTGGG + Intronic
1063641481 10:7835290-7835312 AAGCCGTCCTGGGCCGCATATGG + Intronic
1065037415 10:21653922-21653944 AGGAGGTCCTGAGCCTCCTAAGG - Intronic
1069761650 10:70815768-70815790 AGGCCGTCCTGGGGCGGCTGTGG - Intergenic
1071976976 10:90964934-90964956 AGGCCACCCTGGGGCTGCTTGGG - Intergenic
1072457721 10:95591347-95591369 TGGCCATCCTGGACCTCCTTGGG - Intergenic
1073382151 10:103086918-103086940 AGGCCCTGCTGGGTTTCCTTGGG - Exonic
1073450011 10:103603605-103603627 GGGCCCTCCTCGGCCTCCTTGGG + Exonic
1074815892 10:117140498-117140520 GGGAGCTCCTGGGCCTCCTTGGG + Intergenic
1074905300 10:117857299-117857321 ATGCCCTCCTGTGCCTCCCTGGG - Intergenic
1075132083 10:119748730-119748752 AGGCCGTCCGTGGCCTCCCATGG - Intronic
1075435646 10:122438943-122438965 AAGCCGTCCTGGGCCACATGCGG + Exonic
1075929616 10:126284712-126284734 AGTCAGTCCTCAGCCTCCTTGGG + Intronic
1076881585 10:133242107-133242129 AGGCACACCTGGGCCTCCTTAGG + Intergenic
1077042793 11:531966-531988 AGGGCGTCCTGGTCCTCCAGAGG - Intergenic
1077185800 11:1234847-1234869 GGGCCGTCCTGTGCGTCCTCTGG + Intronic
1077456111 11:2681853-2681875 TGGTAGTGCTGGGCCTCCTTTGG - Intronic
1078476342 11:11633479-11633501 TGGCAGCTCTGGGCCTCCTTCGG - Intergenic
1078703083 11:13708689-13708711 AGGCAGTCATGGGTCTCCATTGG - Intronic
1081296470 11:41395966-41395988 AAGCCGTCCTGGGCCACATGTGG - Intronic
1081686545 11:45047071-45047093 AGGATGTCCTGCCCCTCCTTGGG - Intergenic
1083725261 11:64624515-64624537 AGGTCTTCCTGGGCCTCTCTGGG - Intronic
1085470654 11:76755520-76755542 AAGCCGTCCTGGGCCACATGCGG + Intergenic
1085690246 11:78658460-78658482 TGGCCATCCTGGGCCTCAGTGGG - Exonic
1086728777 11:90222751-90222773 TGCCCCTCCTGGGCCTCCCTTGG - Intronic
1088298549 11:108328836-108328858 AAGCCGTCCTGGGCCACATGCGG + Intronic
1088805725 11:113350359-113350381 AGGCTGACCCGGGCCTCCATGGG + Intronic
1090920092 11:131199270-131199292 AGGCCTCCCTTGGCCTCCCTCGG - Intergenic
1091701972 12:2669405-2669427 AAGCCGTCCTGGGCCGCATGTGG + Intronic
1092286038 12:7129847-7129869 ACGACGTCCTGCCCCTCCTTGGG + Intronic
1095212140 12:39506833-39506855 TGGCTGTCCTTGGCTTCCTTGGG + Intergenic
1096093931 12:48922071-48922093 CAGCCCTCCTGGGCCTCATTGGG - Exonic
1096229074 12:49887555-49887577 TGTCAGTCCTGGGGCTCCTTAGG - Intronic
1098246878 12:68528810-68528832 AGGCCGAGGTGGGCCTCCTGAGG - Intergenic
1098389028 12:69949568-69949590 AAGCCGTCCTGGGCCGCATGTGG - Intronic
1101036901 12:100716047-100716069 GGGCAGACCTGGCCCTCCTTAGG + Intergenic
1102534449 12:113570131-113570153 AGGCTGGCCGGGGCATCCTTGGG - Intergenic
1102842980 12:116146035-116146057 AAGCCGTTCTGGGCCTCATGCGG - Intronic
1104391321 12:128392864-128392886 AAGCCATCCTGGGCCACCTGCGG + Intronic
1104671431 12:130683270-130683292 CGGCTGTCCTTGGCATCCTTGGG - Intronic
1106105206 13:26726967-26726989 AAGCCGTCCTGGGCCTCATGCGG + Intergenic
1107394749 13:40003720-40003742 AGGCCGACCTTGGCCAACTTTGG - Intergenic
1108917323 13:55630893-55630915 AAGCCATCCTGGGCCTCATGAGG - Intergenic
1113335136 13:109370133-109370155 AGGGAGTCCTGGGCCTCCTCAGG - Intergenic
1113456305 13:110451288-110451310 AAGCCGTCCTGGGCCGCATGTGG - Intronic
1115474397 14:33799925-33799947 AAGCCGTCCTCGCCCGCCTTGGG - Exonic
1121492756 14:94371868-94371890 AGGCAGGCCTTGGCCTCCTGAGG - Intergenic
1122698969 14:103574269-103574291 GGGCGGTCCTTGGCCTGCTTTGG + Intronic
1122732138 14:103808526-103808548 AAGCTGTCCTGGGCCTCCTGTGG + Intronic
1122768001 14:104085043-104085065 AGGCCCTGCTGTCCCTCCTTTGG - Intergenic
1123216025 14:106810068-106810090 AGGTCCTCCTGGGCTTCCTCGGG + Intergenic
1123886195 15:24730396-24730418 AAGCCGTCCTGGGCCACATGTGG + Intergenic
1125851886 15:42912045-42912067 AAGCCGTCCTGGGCCACGTGCGG + Intronic
1125886667 15:43234675-43234697 AGGGCAGCCTGGGCCTGCTTAGG - Intronic
1127369290 15:58322254-58322276 AAGCCGTCCTGGGCCACATGTGG + Intronic
1127471616 15:59295439-59295461 TTGCCTTCCTGGCCCTCCTTCGG - Intronic
1128496314 15:68200511-68200533 TGGCCTTCCTGGGCCTCCCAGGG - Intronic
1128606695 15:69041783-69041805 AAGCCGTCCTGGGCCCCATGCGG - Intronic
1129873912 15:78959800-78959822 AAGCCGTCCTGGGGTTCCATGGG - Intergenic
1130828374 15:87573076-87573098 AGGCCCTCCTGGTCCTGCGTGGG - Intergenic
1132612481 16:824296-824318 TGGCCGTCGTGGGCCTGCTGTGG - Intergenic
1132877048 16:2144594-2144616 AGAGCGCCCTGGGTCTCCTTGGG - Intronic
1134599111 16:15519632-15519654 CTGCCCTCCTTGGCCTCCTTGGG + Intronic
1134604530 16:15560005-15560027 AAGCCATCCTGGGCCTAATTTGG + Intronic
1140960633 16:79908851-79908873 AAGCCCTCCTGGGCCTCATCTGG - Intergenic
1141426505 16:83947737-83947759 AGGCCTCCCTCGGCCTCCCTCGG - Intronic
1141573189 16:84947226-84947248 AGCCCGCCCTAGGCCTCTTTGGG - Intergenic
1142610578 17:1107579-1107601 TGGCCCTCATGGGCCTCCTCTGG - Intronic
1146581220 17:34040173-34040195 GGGCCCTCCTGCGCCTCCCTTGG - Intronic
1148631307 17:49111557-49111579 AAGCCGTCCTGGGCCTCATGTGG + Intergenic
1148845493 17:50527475-50527497 AGGCAGTCCTGGGACTCCAGGGG + Intronic
1149646754 17:58246634-58246656 AGGCCGCGCTGGGCCTCCCTGGG - Intronic
1150108540 17:62478964-62478986 GGGCCCTCCTGCGCCTCCCTTGG + Intronic
1152095410 17:78269209-78269231 AGGGCCTGCTGGGCCCCCTTGGG + Intergenic
1152155580 17:78630514-78630536 TGGCCATCCTGGGCGTCCTTTGG - Intergenic
1152357907 17:79815481-79815503 AGGCCGGCCTGGGGCTCCCCGGG - Intergenic
1152421137 17:80193783-80193805 AGTCGGTGCTGGGCCTCCCTGGG + Intronic
1152525783 17:80887586-80887608 AGCCCGTCCTGAGCCTGCTGTGG + Intronic
1153407154 18:4753640-4753662 AAGCCGTCCTGGGCCACATGTGG - Intergenic
1154270057 18:12911343-12911365 TGGGCGTCCTCGGCCTCCTCCGG - Intronic
1155119396 18:22802947-22802969 AAGCCATCCTGGGCCTCATGTGG - Intronic
1159427792 18:68311662-68311684 AGGCTGTCCTGAAGCTCCTTTGG + Intergenic
1159431944 18:68363163-68363185 TGTCCCTCCTGGGCCTCGTTTGG - Intergenic
1160428144 18:78792363-78792385 AGGCTGTGCTGGGCCTGCTGAGG - Intergenic
1160932290 19:1576488-1576510 AGGCCGGCCTGGGCATCTGTGGG - Intronic
1161239368 19:3213453-3213475 AGGCCATGCAGGGCCTCCTGGGG + Intergenic
1161448062 19:4328954-4328976 AGGCCGGACTGGGTCTCCGTGGG - Intronic
1161646252 19:5455220-5455242 AAGCATCCCTGGGCCTCCTTGGG + Intergenic
1162752057 19:12834951-12834973 TGGCCCTTCTGAGCCTCCTTGGG + Intronic
1164544446 19:29147944-29147966 ATGCTGTCTTGGGACTCCTTGGG + Intergenic
1164814539 19:31185222-31185244 GGGCTATCCTGGGCCTCCTCCGG + Intergenic
1164853280 19:31501937-31501959 AGTCCCTCCTGGGCTTCCTTAGG + Intergenic
1165050742 19:33139936-33139958 ATGACCTCCTGGGCCTCCCTGGG + Intronic
1166473073 19:43096921-43096943 CTGCCTTCCTGGGCCTACTTAGG + Intronic
1168084396 19:54034767-54034789 AGCCCGGGCTGGGCCTCCCTGGG - Intergenic
1168413788 19:56156431-56156453 AGACCCTTCTTGGCCTCCTTTGG + Intronic
925390670 2:3491862-3491884 AGGCTCTCCGGGGCCTCCCTGGG - Intergenic
925848690 2:8058549-8058571 AGGCCCTCCTGTGCTTCTTTGGG + Intergenic
927297960 2:21476916-21476938 AGGCAGTCCTGGGCCGCCTGTGG + Intergenic
927520178 2:23693718-23693740 TGGCCGACTTGGGTCTCCTTTGG - Intronic
929760903 2:44805538-44805560 AGGGAGTCCTGGCCCTCCTTTGG - Intergenic
930026094 2:47029975-47029997 AGGCCGTGCTGGGCCACCTGAGG + Intronic
930383570 2:50662506-50662528 AAGCTGTCCTGGGCCTCCTGCGG - Intronic
932323236 2:70837363-70837385 AAGCTGTCCTGGGCCTGCTGAGG + Intergenic
933192835 2:79355564-79355586 AGTCTGTACTGGGTCTCCTTTGG - Intronic
933902341 2:86859106-86859128 AGCCTGTCCTGGGTCTCCTTCGG - Intronic
935778204 2:106490162-106490184 AGCCTGTCCTGGGTCTCCTTCGG + Intergenic
937005621 2:118510151-118510173 AGGCCTTCCTAGGCTTTCTTAGG - Intergenic
937952351 2:127398277-127398299 AGGCAGTCCTGGGCCTGTTGTGG - Intergenic
939068219 2:137508996-137509018 AGGTCGTCCTGGGGCACCATGGG + Intronic
939178580 2:138780090-138780112 AGCCCAGCCTGGGCCTGCTTGGG - Intronic
941039042 2:160599790-160599812 AGGCCAGCCTGGGGCTGCTTAGG - Intergenic
942692358 2:178599425-178599447 AGGTCGTCCTGGCCCTCCAGTGG - Exonic
944105714 2:196077162-196077184 AAGCTGTCCTGGGCCACATTTGG - Intergenic
946893651 2:224301572-224301594 AGGCTATGCTGAGCCTCCTTAGG + Intergenic
948012136 2:234657280-234657302 AAGCCTTCCTGGGCCGCCTGTGG - Intergenic
948039066 2:234884846-234884868 TGGCAGTCCTAGGCCTTCTTTGG - Intergenic
948461052 2:238130189-238130211 AGGCCATCCTGGGGCCCTTTGGG + Exonic
948702095 2:239766934-239766956 AGTCAGTCCGGGGGCTCCTTAGG - Intronic
948738430 2:240025833-240025855 AGGCCGGCCTGGGTCGCCTCCGG + Intergenic
1169274014 20:4221173-4221195 AGGCCTTCCTGGCCATGCTTGGG + Exonic
1170324716 20:15144025-15144047 AAGCCATCCTGGGCCTCATGTGG + Intronic
1170766125 20:19291241-19291263 AGGCCTACCTGGGCCTCCCTGGG - Intronic
1172067898 20:32234494-32234516 AGGTCGACCTGGGCCACCTCAGG - Exonic
1172132249 20:32663790-32663812 AGGCCGTCCTAGGCCTCCTGTGG - Intergenic
1172913586 20:38427926-38427948 AGGCCCTACTGGGCTTCCCTGGG + Intergenic
1175316749 20:58054000-58054022 AGGGCTTCCTGGGCTTCCTAAGG + Intergenic
1175539710 20:59740911-59740933 AGGCCGTCCTGGGCCTCCTTGGG + Intronic
1175912390 20:62411066-62411088 AGGGCCTCCTGGGTCTCCTCTGG + Intronic
1176023835 20:62975936-62975958 AGGCAGTCCTGCGCCTGCTGGGG - Intergenic
1176023884 20:62976107-62976129 AGGCAGTCCTGTGCCTGCTGGGG - Intergenic
1178687590 21:34723545-34723567 AGGCTGCCCTGGGCCTTCTGGGG - Intergenic
1178757246 21:35363460-35363482 AGGCCGTCCTTGGACTTCCTTGG - Intronic
1179427597 21:41294269-41294291 AAGCCCTCCTGGTCCTCCTGAGG + Intergenic
1179590405 21:42404259-42404281 AAGCTGTCCTGGGCCTCATGTGG - Intronic
1180054915 21:45352738-45352760 AGCCCCTCCTCGGCCTCCTCCGG + Intergenic
1181522712 22:23458755-23458777 AGGCCGCCCTGTGGCTCCTGGGG + Intergenic
1181634158 22:24166717-24166739 AGGCCCTCCTGGCCATCCTCAGG - Exonic
1182050753 22:27310938-27310960 GGGCCGTCCTGAGCATCCTAGGG - Intergenic
1182444788 22:30383750-30383772 AGGCCGTCCATGGGCTTCTTGGG - Intronic
1183931585 22:41238674-41238696 AGCCCGTCCAGCGCCTCCTGGGG + Exonic
950503646 3:13379642-13379664 CGGCCGGGCTGGGTCTCCTTCGG + Exonic
950780799 3:15389963-15389985 AGGCAGTACTGTGCCTCCCTTGG - Intronic
951041341 3:17991874-17991896 AAGCCGTCCTGGGCCACATGTGG - Intronic
952887779 3:38022109-38022131 AGGCATCCCTGGGCCTCCTCAGG + Intronic
953891885 3:46756848-46756870 AGGCCGTCCTGGGACGCCATGGG + Intronic
954164648 3:48746505-48746527 AGGCCGTCATAGCACTCCTTTGG - Intronic
954400683 3:50317998-50318020 ATGCCCTCCTGGGCTTCCTGGGG + Exonic
954605205 3:51904252-51904274 AGGCCCTCATGGGGTTCCTTGGG - Intergenic
955759157 3:62259470-62259492 AAGCCATCCTGGGCCGCCTGTGG + Intronic
958688992 3:97436964-97436986 AAGCCGTCCTGGGCCACGTGTGG - Intronic
959913239 3:111788670-111788692 AAGCTGTCCTGGGCCTCATGAGG - Intronic
961183490 3:124894997-124895019 AAGCCATCCTGGGCCTCATGTGG + Intronic
964505323 3:157392689-157392711 AAGCTGTCCTGGGCCTCATGTGG + Intronic
964785754 3:160394387-160394409 AGGCTGTCCTGGGCCGCATGTGG + Intronic
967549066 3:190767999-190768021 CCGCCTTCCTAGGCCTCCTTTGG - Intergenic
967669664 3:192218067-192218089 AGGCCGACGTGGGCCACCTGAGG - Intronic
968978763 4:3835540-3835562 TGGGCCTCCTGGGCCTCCTGGGG + Intergenic
968982616 4:3858597-3858619 AGGCATTCCTGGGGCTGCTTAGG + Intergenic
969040308 4:4290431-4290453 ATGCCCTTCTGGGCCACCTTCGG - Intronic
971209963 4:24606727-24606749 AAGCTGTCCTGGGCCTCATGTGG + Intergenic
973827660 4:54724828-54724850 AAGCCGTCCTGGGCCACATGTGG + Intronic
976334430 4:83869252-83869274 AGGCAGTCCTTGGCATCCCTCGG - Intergenic
980256854 4:130392804-130392826 AAGCCGTCCTGGGCCACATTGGG + Intergenic
980902427 4:138917686-138917708 AAGCCATCCTGGGCCTCATGTGG + Intergenic
981812871 4:148795277-148795299 AGGCTGTTCTGGCCCTCTTTGGG + Intergenic
982550861 4:156797698-156797720 AAGCCGTCCTGGGCCACATGGGG + Intronic
983231254 4:165131076-165131098 AGGTCGTCCAGGGCCTGCTCAGG - Intronic
983436158 4:167718496-167718518 AAGCCGTCCTGGGCCACATGTGG - Intergenic
985772503 5:1821705-1821727 TGGCCGTCCTTGGCCTTCTTTGG + Intergenic
986481138 5:8189452-8189474 AAGCCCTTCTGGGCCACCTTCGG - Intergenic
988547357 5:32171354-32171376 AAGCCATCCTGGGCCACATTTGG + Intronic
990342192 5:54834507-54834529 ACTCGGTCCTGGGTCTCCTTGGG + Intergenic
992916714 5:81462245-81462267 AAGCCGTCCTGGGCCACATTTGG + Intronic
994699698 5:103118896-103118918 AGACTGTCCTGGGACTTCTTTGG + Intronic
996013685 5:118507810-118507832 AGGCAGTGGTTGGCCTCCTTTGG + Intergenic
997079847 5:130725356-130725378 AAGCCGTCCTGGGCCTCATGTGG - Intergenic
997960350 5:138316179-138316201 AGGCCTTCCTGGGCCCCCAAGGG - Intronic
1001648612 5:173299822-173299844 GGGCAGACCTGGGCCTCATTAGG - Intergenic
1003212469 6:4079486-4079508 CGGCCTTCCTGGGCCTCCTCGGG + Exonic
1004682012 6:17905043-17905065 AAGCCGTCCTGGGCCCCATGAGG - Intronic
1005123080 6:22412699-22412721 AAGCCGTCCTGGGCCACCTGAGG - Intergenic
1005377239 6:25195916-25195938 AAGCTGTCCTGGGCCGCCTGCGG + Intergenic
1005389551 6:25319233-25319255 AGGCCGTACTGGGCATCATGTGG + Intronic
1005803219 6:29447805-29447827 TGGCCTGGCTGGGCCTCCTTAGG + Intronic
1005807550 6:29488601-29488623 ACCCAGTCCTGGGCATCCTTGGG + Intergenic
1006118600 6:31790177-31790199 AAGCCGTCCTGGGCCGCATGTGG + Intronic
1006313745 6:33278504-33278526 AGGGAGTCCTGGGCATCCTGCGG + Exonic
1006369154 6:33633666-33633688 AGGCCGCGCTGGCCCTCCCTTGG + Intronic
1007737902 6:43993258-43993280 AGGGCTTCCTGGGGCTCCTGGGG + Intergenic
1008155463 6:48008737-48008759 AGCCCTTCCTGGGCCTCCTGGGG - Exonic
1013841298 6:114397485-114397507 AAGCCATCCTGGGCCTCATGTGG - Intergenic
1015235479 6:130966102-130966124 AAGCTTTCCTGGGCCTCCTGCGG + Intronic
1016113770 6:140258263-140258285 AGGCTGTGCTGAACCTCCTTAGG - Intergenic
1016166706 6:140954190-140954212 ACTCCGTCCTCGGCCTCCTAAGG + Intergenic
1017251092 6:152280362-152280384 AGGCTGTCCTGGGCCACATGCGG - Intronic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019588613 7:1817782-1817804 AGGCCGCCCTGTGGCTCCTGGGG - Intronic
1020012942 7:4816322-4816344 AGGCAGCCCTGGACCTCCTGCGG - Exonic
1020109416 7:5439769-5439791 AGCCCTTCCTGGGGCTCCTGGGG + Intronic
1021292450 7:18863343-18863365 AAGCCGTCCTGGGCCCCATGTGG - Intronic
1022943179 7:35258343-35258365 TGTCCGCCCTGGGCCTCCTCCGG + Intergenic
1023311553 7:38892529-38892551 AGGCAGGTCTGGGCCCCCTTTGG - Intronic
1023757571 7:43433917-43433939 AGCCAATCCTGGGCATCCTTGGG - Intronic
1023849091 7:44140473-44140495 AGGGCGGCCTGGGCCTTCTGGGG - Intronic
1023974194 7:45015693-45015715 AGGACGTCCTGGGCCACCTCTGG - Intronic
1024645483 7:51367294-51367316 GTTCAGTCCTGGGCCTCCTTAGG - Intergenic
1028954864 7:96677188-96677210 AAGCTGTCCTGGGCCTCTTAGGG - Intronic
1029500635 7:100927227-100927249 AGGCTGTGCTGAACCTCCTTAGG + Intergenic
1030307993 7:108038578-108038600 AAGCCGTCCTGGGCCACATGTGG - Intronic
1032322248 7:130896077-130896099 GGGCCGTCCAGGGCCTCCACAGG - Intergenic
1032383431 7:131505974-131505996 AAGCGGTCCTCGGCCTCCTCCGG + Exonic
1035462275 7:159049428-159049450 GGGCCCTCCAGGGCCTCCGTGGG + Intronic
1036702862 8:11024713-11024735 TGGCCCTCTTGGGCCTCCCTGGG - Intronic
1042211165 8:66381833-66381855 AAGCCGTCCTGGGCCGCTTGTGG - Intergenic
1043661286 8:82745455-82745477 AGACCCTCCAGGCCCTCCTTTGG - Intergenic
1044346329 8:91108648-91108670 AAGCCGTCCTGGGCCGCATGTGG - Intronic
1045211680 8:100106097-100106119 TGGCCGGCCTCGGCCTCCCTGGG - Exonic
1045596496 8:103662165-103662187 AGGCTGTCCTGGGCCTCATGTGG + Intronic
1047588193 8:126297597-126297619 AAGCCGTCCTGGGCTGCCTGTGG + Intergenic
1047856792 8:128919527-128919549 AGGCTGTGCTGAACCTCCTTAGG + Intergenic
1048581379 8:135732109-135732131 AGGCAGTCCTGGGCATTCCTAGG + Intergenic
1049022088 8:139964257-139964279 AGGCCTTCCCTGGCCTCCTGAGG - Intronic
1049245720 8:141561274-141561296 TGGCCATCCAGGGCCTCCATGGG - Intergenic
1049420182 8:142512996-142513018 ACACAGTCCTGGGCCTTCTTTGG + Intronic
1049806565 8:144543582-144543604 TGGCCTTCATGGGCCTTCTTTGG + Intronic
1051123818 9:13780982-13781004 AAGCAGTCCTGGGCCTCATGTGG - Intergenic
1055587745 9:77772994-77773016 AAGCCGTCCTGGGCCACGTGAGG + Intronic
1057805126 9:98214692-98214714 AGGTGGTCCTGGCCCTCCCTGGG + Intronic
1059994580 9:119896525-119896547 AAGCGGTCCAGGGCCTCTTTTGG + Intergenic
1061202391 9:129145496-129145518 AGGCCTTGGAGGGCCTCCTTAGG - Intronic
1061908538 9:133711083-133711105 GGGCAGGCCTGGGCCTCCCTCGG - Intronic
1062405326 9:136393514-136393536 AGGCTGTGCTGTGCCTTCTTTGG + Intronic
1185478980 X:432405-432427 AGGCCGTCCTGGGCCCTGTAGGG + Intergenic
1185479002 X:432534-432556 AGGCCGTCCTGGGCCCTGTAGGG + Intergenic
1186344187 X:8674665-8674687 AAGCCGTCCTGGGCCTCATGCGG + Intronic
1190069405 X:47267017-47267039 AAGCCGTCCTGGGCCACATGTGG - Intergenic
1191877289 X:65809648-65809670 TGGCAGTTCTGGGCCTCCTTGGG + Intergenic
1193418375 X:81252689-81252711 AAGCCGTCCTGGGCCACATGTGG + Intronic
1198576082 X:138011691-138011713 GTGCCCTACTGGGCCTCCTTGGG - Intergenic
1198646774 X:138816681-138816703 AAGCTGTCCTGGGCCTCATGCGG - Intronic
1202033646 Y:20607011-20607033 AGCTCGTCCTGGGCTTCTTTTGG + Intergenic
1202582225 Y:26393864-26393886 AAGCTGTCCTGGGCCTCATGTGG + Intergenic