ID: 1175539710

View in Genome Browser
Species Human (GRCh38)
Location 20:59740911-59740933
Sequence AGGCCGTCCTGGGCCTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175539705_1175539710 -9 Left 1175539705 20:59740897-59740919 CCCAGATTCAGAGCAGGCCGTCC No data
Right 1175539710 20:59740911-59740933 AGGCCGTCCTGGGCCTCCTTGGG No data
1175539703_1175539710 27 Left 1175539703 20:59740861-59740883 CCTCATATGGCTCTTCTCAGGCT No data
Right 1175539710 20:59740911-59740933 AGGCCGTCCTGGGCCTCCTTGGG No data
1175539706_1175539710 -10 Left 1175539706 20:59740898-59740920 CCAGATTCAGAGCAGGCCGTCCT No data
Right 1175539710 20:59740911-59740933 AGGCCGTCCTGGGCCTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175539710 Original CRISPR AGGCCGTCCTGGGCCTCCTT GGG Intronic