ID: 1175543054

View in Genome Browser
Species Human (GRCh38)
Location 20:59760172-59760194
Sequence CCTGACACCCACACTCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 8, 3: 32, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175543054_1175543058 8 Left 1175543054 20:59760172-59760194 CCATGATGAGTGTGGGTGTCAGG 0: 1
1: 0
2: 8
3: 32
4: 199
Right 1175543058 20:59760203-59760225 CTGAATATTGCAAATCTCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 162
1175543054_1175543060 14 Left 1175543054 20:59760172-59760194 CCATGATGAGTGTGGGTGTCAGG 0: 1
1: 0
2: 8
3: 32
4: 199
Right 1175543060 20:59760209-59760231 ATTGCAAATCTCTCAGGAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 206
1175543054_1175543059 11 Left 1175543054 20:59760172-59760194 CCATGATGAGTGTGGGTGTCAGG 0: 1
1: 0
2: 8
3: 32
4: 199
Right 1175543059 20:59760206-59760228 AATATTGCAAATCTCTCAGGAGG 0: 1
1: 0
2: 1
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175543054 Original CRISPR CCTGACACCCACACTCATCA TGG (reversed) Intronic
900138609 1:1129223-1129245 CCAGACACCCATAATCATCACGG - Intergenic
900876990 1:5349922-5349944 CCTGACACTCATCCCCATCATGG + Intergenic
901946486 1:12708169-12708191 CCTGGCACCCACCCTCATCAGGG - Intergenic
901965648 1:12863750-12863772 CCTCCCTCCTACACTCATCAAGG - Intronic
901981045 1:13034128-13034150 CCTCCCTCCTACACTCATCAAGG - Intronic
902001042 1:13194802-13194824 CCTCCCTCCTACACTCATCAAGG + Intergenic
902020272 1:13340506-13340528 CCTCCCTCCTACACTCATCAAGG + Intergenic
902228000 1:15008842-15008864 CCTGCCAGCCACAGTCCTCAAGG + Intronic
902701874 1:18178044-18178066 CCTGACAACCTCACACTTCAAGG - Intronic
907144527 1:52220210-52220232 CCTGGCATCCACCTTCATCAGGG - Intronic
907962425 1:59296404-59296426 TCTGACACACACACCCATCAGGG + Intergenic
908569505 1:65393890-65393912 TCTGAGACCCACACTCATGAAGG - Intronic
909480078 1:76121315-76121337 CCTGCCACCCTCACTCACCTGGG + Intronic
910592894 1:88947139-88947161 ACTGACCCCCACCCTCCTCATGG + Intronic
911464998 1:98240307-98240329 CCTGACCCCTTCACTCACCATGG - Intergenic
912911856 1:113769196-113769218 CCTCACCCCCAAACTCCTCAGGG + Intronic
913216946 1:116628572-116628594 CCTGCCACCCACACTCTTGGTGG - Intronic
915169770 1:153969451-153969473 GCTGACACCAAGACTCACCAGGG - Exonic
917626743 1:176854089-176854111 TCTGACACTCACATTCTTCAGGG - Intergenic
918784862 1:188751780-188751802 CCCGACACCCACACCCGTAAAGG - Intergenic
919646149 1:200096399-200096421 CCTGACACTCAAACACAACAGGG + Intronic
920850228 1:209623504-209623526 CCTGACACCCACCTTCAACAAGG - Exonic
920922827 1:210312232-210312254 ACCCACACCCACACTCCTCACGG + Intergenic
921505031 1:215957753-215957775 CCTGACCCCCTAACTCATTACGG + Intronic
923689292 1:236176980-236177002 CCTCACACGCACACACACCATGG - Intronic
1064756423 10:18575588-18575610 CCTGGCACCAACCCTCATCAGGG + Intronic
1064859621 10:19814156-19814178 CCTGACCCCCATACTGTTCAAGG - Intergenic
1068417326 10:56740815-56740837 CTTAACACCCACACTGTTCAAGG + Intergenic
1070200109 10:74196190-74196212 CCTAACAGCATCACTCATCAGGG + Intronic
1070692836 10:78540461-78540483 CCTGTCACCCTCACCCATCTGGG - Intergenic
1072391749 10:94994365-94994387 TCTGACACCTACCTTCATCAAGG - Intergenic
1072689432 10:97562031-97562053 CCTGACTCCCCCTCCCATCATGG - Intronic
1074001186 10:109374896-109374918 CCTAACACCCACATTGTTCAAGG + Intergenic
1075624649 10:123953413-123953435 ACTGACCCCCACACTCTTCATGG - Intergenic
1076192248 10:128491159-128491181 AGTGGCACCCACTCTCATCATGG + Intergenic
1076533726 10:131162306-131162328 CCTGCCACCGACACTGACCATGG + Intronic
1077292682 11:1805765-1805787 CGTGATAACCACCCTCATCAAGG + Intergenic
1077409765 11:2398489-2398511 TCGGCCACCCACAGTCATCATGG + Intergenic
1077703373 11:4461809-4461831 CCTGGCACCTGCCCTCATCAGGG + Intergenic
1077866924 11:6230117-6230139 CCTTACAGCCACACACAGCAAGG + Intronic
1081100427 11:38995083-38995105 CCTGGAAGCCACACTCATGAAGG - Intergenic
1082794723 11:57370795-57370817 CCCCACACCCACACACATCTGGG + Intergenic
1083254062 11:61485659-61485681 CCTGCCACCCACGATCCTCATGG + Intronic
1084261279 11:67980402-67980424 CCTTACACCCACAGTCCTCCAGG + Intergenic
1084859342 11:72007918-72007940 CCTCTCACCTAGACTCATCATGG + Intronic
1086637560 11:89107388-89107410 ACTGACTCCCACACTCCACATGG - Intergenic
1088510697 11:110571017-110571039 TCACACACCCACACTCATCCTGG + Intergenic
1089028697 11:115299515-115299537 CCAGACACCAATACGCATCATGG + Intronic
1089191020 11:116653396-116653418 CCGGACACCCCCACGCATCCTGG - Intergenic
1089809703 11:121121613-121121635 ACTGACACCCACAGTCACCCAGG + Intronic
1090806087 11:130203205-130203227 CGTGACCCCAACACTCAGCATGG - Intronic
1093418402 12:18947051-18947073 CCTGCCACCCACACCCATCATGG + Intergenic
1094317520 12:29149534-29149556 CCTCACACCCACCCTCCTCGAGG - Intronic
1095187400 12:39216689-39216711 CCTAACCCCCACACTGCTCAAGG + Intergenic
1096047253 12:48573325-48573347 CCTGAGAGCCACAGTCATAATGG + Intergenic
1096594082 12:52683399-52683421 CCACACACCCACACTGATCCTGG - Intergenic
1098091630 12:66908272-66908294 CCTGCCACCCACACTCTGCCTGG - Intergenic
1098784815 12:74739311-74739333 CCTCAAACCCACATTCTTCAAGG + Intergenic
1102606292 12:114070099-114070121 CCTGGCACCCACCCTCATCAAGG + Intergenic
1103060359 12:117853754-117853776 CCTGTCAGCCACACTCATGTTGG + Intronic
1103601749 12:122058888-122058910 CCTCACACCCAAACTCTTCCTGG - Intronic
1104303685 12:127589995-127590017 CCTGACAGCCACACTTAGCAAGG - Intergenic
1107560318 13:41551996-41552018 CCCCACACCCAGACTCCTCAGGG + Intergenic
1110892131 13:80706440-80706462 CCTGATACCCACAGTCCTCCAGG - Intergenic
1112946381 13:104931852-104931874 CCTGACACACACACACATTATGG + Intergenic
1113559774 13:111269471-111269493 CCTGACAAACACACTCATTAAGG - Intronic
1113877599 13:113604426-113604448 ACTCACACCCACACTCCTAAGGG + Intronic
1116541635 14:46108281-46108303 CCTGGCACCCACTCTGATCTGGG - Intergenic
1118886797 14:69874080-69874102 CCAGACACCCAGACTCTTCGTGG - Intronic
1119161683 14:72458125-72458147 CCTCACCCCCACACTGAGCAAGG + Intronic
1121280316 14:92692848-92692870 CCTGCCCTCCCCACTCATCAGGG + Intergenic
1122894385 14:104749043-104749065 CCTGGCCCCCACACCCCTCACGG + Intergenic
1122938862 14:104972363-104972385 CCTGACACCCACACTCAGCCAGG + Intronic
1123065427 14:105616688-105616710 TCTAACACCCACACTCAGCAAGG - Intergenic
1123069630 14:105636154-105636176 TCTGCTACCCACACTCAGCAAGG - Intergenic
1123088723 14:105731937-105731959 TCTGCTACCCACACTCAGCAAGG - Intergenic
1123094657 14:105761196-105761218 TCTGCTACCCACACTCAGCAAGG - Intergenic
1124441770 15:29690654-29690676 CCTGGCACCCACACACAGCCTGG + Intergenic
1124558464 15:30748783-30748805 CCTGAGACCCTCAGTCCTCAGGG + Intronic
1124672789 15:31656847-31656869 CCTGAGACCCTCAGTCCTCAGGG - Intronic
1125316747 15:38440682-38440704 CCTGCCAGCCGCCCTCATCAGGG - Intergenic
1125456810 15:39868384-39868406 CCTGATACTCACAGTCAGCATGG - Intronic
1125690230 15:41590192-41590214 CCTGGCACCCACCCTCATCAGGG + Intergenic
1126730329 15:51675669-51675691 CCTGACCACCACACTAATGAAGG + Intergenic
1127803367 15:62496437-62496459 CCTGACACCCATCCTAGTCACGG - Intronic
1128727622 15:69999539-69999561 CCAGACACCCACCCACCTCAGGG + Intergenic
1130838016 15:87670992-87671014 CATGCCACCCACACACATCCAGG + Intergenic
1132930107 16:2454672-2454694 GCTGACACCCACACCCAACTGGG - Intronic
1132937051 16:2486501-2486523 CCTGACCACCACACACATCCTGG - Intronic
1133960807 16:10491887-10491909 CTTGACACCCACCTTCATCAGGG + Intergenic
1135113293 16:19707278-19707300 CTTGACCCCCACCCTCATCAGGG + Intronic
1135479676 16:22812916-22812938 CATGACCCCCACCCTGATCAGGG - Intergenic
1136393929 16:29982754-29982776 GCGGCCACCCACAGTCATCATGG + Exonic
1137520810 16:49193943-49193965 CCAGGCACCCTCACTCCTCAGGG - Intergenic
1138250256 16:55496801-55496823 CCTGCCTCCCACTCCCATCATGG + Intronic
1139443385 16:66980318-66980340 CCTAACACCCACATTGTTCAAGG + Intergenic
1141441647 16:84033270-84033292 CCTGACACAAACACTCAGCAAGG + Intronic
1143118953 17:4595634-4595656 CCTCACACCCACATTCCCCAGGG + Intronic
1145997792 17:29114548-29114570 CCTGGCACCCTCACAGATCAGGG + Intronic
1146939724 17:36836127-36836149 CCTCACACACACACTCCTCAGGG - Intergenic
1149288569 17:55193434-55193456 CCTGACATCAATTCTCATCATGG + Intergenic
1152822860 17:82446025-82446047 CCTCACCCCCACCCTCACCAGGG + Intronic
1155517793 18:26640518-26640540 GCTCACACACAGACTCATCAAGG - Intronic
1157006499 18:43589982-43590004 CCTGGCACCCACTCTGATCTTGG - Intergenic
1160713259 19:563235-563257 CCTGGCATCCACCCTCATCAGGG - Intergenic
1162267907 19:9591010-9591032 CCTGGCACCCACCCTCATCAGGG - Intergenic
1162323311 19:9983153-9983175 CCTGGCCCCAACACTCTTCAAGG + Intronic
1163458755 19:17424063-17424085 CCTGAGACCCCGACTCACCAGGG - Exonic
1164574647 19:29398607-29398629 CCTCCCACCCACACTCACCTGGG + Intergenic
1165142098 19:33705728-33705750 CATGGCAGCCACACTCAGCAAGG + Intronic
1167089982 19:47337229-47337251 ACTGACACCCACAGTCATGGAGG + Intronic
1167671682 19:50857217-50857239 CCTCATACCCACACACATCAGGG - Intronic
925301975 2:2823324-2823346 CCTTACCCCCACACCCATGATGG + Intergenic
925381882 2:3433972-3433994 CTTGACAACCACCCTCAGCATGG + Intronic
926218010 2:10917129-10917151 CTTGGCACCCACACTGTTCATGG - Intergenic
928308815 2:30193323-30193345 CCAGGGCCCCACACTCATCAGGG + Intergenic
928366328 2:30706054-30706076 CCTGCCACCCCCACCCCTCAAGG - Intergenic
928416699 2:31098628-31098650 CCTAACCCCCACACTGCTCAAGG - Intronic
929615180 2:43301135-43301157 GCTGAGAACCACACTCCTCAGGG + Intronic
930677498 2:54219426-54219448 CCTCAAACCCAAACTCTTCACGG - Intronic
932576324 2:72964268-72964290 CCTGACTCCCTCACCCAACAGGG + Intronic
933177527 2:79192169-79192191 ACTGATTCCCACACCCATCATGG + Intronic
934857841 2:97739881-97739903 CCTGACACCTACCCTCACCCCGG - Intergenic
936716427 2:115192047-115192069 CCTGGCACCCACCTTCATCAGGG - Intronic
937339989 2:121085178-121085200 CCTGCCACCCCCACTAATGACGG - Intergenic
940352711 2:152706902-152706924 CTTGACACCCACCTTCATCACGG + Intronic
940400401 2:153242279-153242301 CTTCCCACCCACACCCATCATGG + Intergenic
942534195 2:176946077-176946099 CCTTACTCCCACTCTCACCATGG + Intergenic
945483497 2:210368363-210368385 CCTGGCACCCACCTTCATCAGGG - Intergenic
946386261 2:219386223-219386245 ACTGACTGCCACACTCCTCAGGG - Intronic
948484248 2:238270607-238270629 TCTGACCCCCACTCTCCTCAGGG - Intronic
1168824097 20:797504-797526 CCTGGCACCCACCCTCATCAGGG + Intergenic
1170314397 20:15027761-15027783 CCTGAAACCCACACATATTAGGG - Intronic
1173294734 20:41747032-41747054 CCTCCCAGCCACCCTCATCAAGG - Intergenic
1173804089 20:45912589-45912611 CCTGCCACCCACAATCATCTCGG + Intergenic
1175543054 20:59760172-59760194 CCTGACACCCACACTCATCATGG - Intronic
1176305743 21:5122232-5122254 CCTGAGACCCACAGTCAGAAAGG - Intronic
1176381759 21:6117322-6117344 CCTGATTCCCAGACTCAACAAGG - Intronic
1177492551 21:21846228-21846250 CCTGACATCCCTACACATCACGG + Intergenic
1178962073 21:37074068-37074090 CGTGACACGCACACACAGCAAGG - Intronic
1179312505 21:40209194-40209216 CCTGTCACTCACTGTCATCAAGG - Intronic
1179413444 21:41179405-41179427 CCTGACACCCTCACTCACCCTGG - Intronic
1179741713 21:43420917-43420939 CCTGATTCCCAGACTCAACAAGG + Intronic
1179851315 21:44139799-44139821 CCTGAGACCCACAGTCAGAAAGG + Intronic
1180818297 22:18806955-18806977 CCTGCCACCCACACTCTTGGTGG - Intergenic
1181204520 22:21241410-21241432 CCTGCCACCCACACTCTTGGTGG - Intergenic
1181499035 22:23305418-23305440 CCTCTCACCCACCCTCAGCAGGG - Intronic
1181644648 22:24224831-24224853 ACTGACAGCCTCACCCATCAAGG + Intronic
1181922788 22:26333611-26333633 CCCGAGACACACACTCAGCATGG + Intronic
1182076617 22:27499467-27499489 CCTGGCACCCACAGGCCTCATGG - Intergenic
1182192354 22:28475333-28475355 ACTCACACCCACACTCATACTGG + Intronic
1184064433 22:42109219-42109241 CTTGGCACCCACCTTCATCAGGG - Intergenic
1184475879 22:44721014-44721036 ATTCACACCCGCACTCATCATGG + Intronic
1203222405 22_KI270731v1_random:54005-54027 CCTGCCACCCACACTCTTGGTGG + Intergenic
1203268425 22_KI270734v1_random:32809-32831 CCTGCCACCCACACTCTTGGTGG - Intergenic
949855426 3:8456997-8457019 CATGACACCCTCACTCTGCATGG + Intergenic
949986456 3:9545052-9545074 CCTGACACACACACACGACACGG + Intronic
950594402 3:13966079-13966101 CCTGGCACCCACCTTCATCAGGG - Intronic
950846240 3:16018595-16018617 CCTGGCACCCACCCTCATCAGGG - Intergenic
951877291 3:27441291-27441313 CCTGATACCAAAACTAATCAGGG - Intronic
958195236 3:90235390-90235412 CCTGGCACCCACTCTGGTCATGG + Intergenic
958418650 3:93906795-93906817 CCTGGCACCCACTCTGGTCATGG + Intronic
961378071 3:126480176-126480198 ACTGAACCCTACACTCATCATGG + Intergenic
963221391 3:142816813-142816835 CCAGTCACCCACTGTCATCAGGG + Intronic
964821367 3:160773922-160773944 CTTGAAACCCAGACTCATGAAGG - Intronic
966256030 3:177917610-177917632 CCTGGCACCCACTCAGATCATGG + Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
968453950 4:687936-687958 CCTGACACCAAGAGTCGTCATGG - Intronic
969019798 4:4132267-4132289 CCTTACACCCACAGTCATCCAGG + Intergenic
969024505 4:4162670-4162692 CCTTACACCCACAGTCCTCCAGG + Intergenic
969025410 4:4168618-4168640 CTTGATACCCACACTCCTCCAGG + Intergenic
969793639 4:9509203-9509225 CCTTACACCCACAGTCCTCCAGG - Intergenic
971376330 4:26058662-26058684 CCTGGCACCCGCACTGAGCAGGG - Intergenic
984843913 4:184093912-184093934 CCTCCCACCCACACACAGCAAGG - Intronic
984948447 4:184988557-184988579 CCTGTCACCAGCACTCATCTGGG - Intergenic
985097072 4:186423430-186423452 CCTGCCACCCACTCTTAGCATGG + Intergenic
985527152 5:411759-411781 GCTGACAGCCACAAACATCATGG + Intronic
985714361 5:1446952-1446974 CCTGACACCACCTCCCATCAGGG + Intergenic
987105882 5:14638601-14638623 ACACACACACACACTCATCATGG - Intergenic
989613625 5:43318246-43318268 CCTGACACCCATCCTCATTAGGG - Intergenic
990252921 5:53935272-53935294 CTTTACACCCACCCTCATCCAGG + Intronic
990339100 5:54804832-54804854 CCTCACACACACCCCCATCACGG + Intergenic
993320335 5:86462297-86462319 CCTTATACCCACAGTCATCCAGG - Intergenic
995242300 5:109899232-109899254 TGTGACGCCCACACACATCAGGG - Intergenic
995324916 5:110879557-110879579 ACTGAAATCCACAATCATCATGG - Intergenic
997196456 5:131983493-131983515 CCTGGCTCCCAGCCTCATCAAGG - Intronic
997986416 5:138504892-138504914 CCTGAGACCCAGTCCCATCAGGG + Intergenic
999368010 5:151035489-151035511 CCTGACATCCAGCCTCACCAGGG + Intronic
1001330688 5:170760321-170760343 CCAGAGAACCACACTCAACAGGG + Intergenic
1001526205 5:172430481-172430503 CCTGACACCCCCACCCACCCTGG + Intronic
1001777558 5:174340043-174340065 CCTGACACACAACCTCAGCAAGG + Intergenic
1001993392 5:176134950-176134972 CCTGCCACCCACCCTCGTCAGGG + Intergenic
1003053719 6:2801340-2801362 CCTGACATGCACACTCTTCTTGG + Intergenic
1004339337 6:14794632-14794654 CCTAACTCCCACACTGTTCAAGG + Intergenic
1005575223 6:27183864-27183886 CCTGGCACCCGCCCTCATCAGGG + Intergenic
1011147112 6:84229802-84229824 CCTCTCACCCCCACTCACCAAGG + Intergenic
1014525244 6:122494897-122494919 CCTGACACCTTCACTCCTCCAGG + Intronic
1015550936 6:134411888-134411910 CCAGACACCCAGACTGATGAGGG + Intergenic
1017491070 6:154945437-154945459 CCTGGTCCCCACACTCACCATGG + Intronic
1017858891 6:158376814-158376836 CCTGACAGCCACATTCAACAGGG - Intronic
1018837301 6:167494629-167494651 CCTCACACACACACACATCAGGG - Intergenic
1018914986 6:168127656-168127678 CCTGTGCACCACACTCATCAGGG + Intergenic
1020745325 7:12072345-12072367 CTTGGCACCCACCTTCATCAGGG + Intergenic
1021116922 7:16754376-16754398 CCTGACATCCAGACGCATCTGGG + Intronic
1021142730 7:17047687-17047709 CCTGACCCACAAACCCATCATGG + Intergenic
1021949532 7:25761295-25761317 CCAGACACCCACAGTCATGGGGG + Intergenic
1021949949 7:25764874-25764896 CCAGACACCCACAGTCATGGGGG + Intergenic
1023404337 7:39815938-39815960 CCTGAAACCCAAACACTTCAAGG - Intergenic
1023837624 7:44077643-44077665 CCTCACTCCCACACTCACCACGG + Intronic
1025075812 7:55942160-55942182 CCTGATTCCCACCCTCAACATGG - Exonic
1029078336 7:97953241-97953263 CCTTACACCCACAGTCCTCCAGG + Intergenic
1029140009 7:98402525-98402547 CCTGAGACCCGCACCCAACAAGG + Intergenic
1029731172 7:102439177-102439199 CTTGGCGCCCACACTCACCATGG - Exonic
1033097643 7:138444712-138444734 CCTGGCACACCCCCTCATCAGGG - Intergenic
1033501505 7:141954988-141955010 CCTGACCCCCACACCCAACATGG - Intronic
1034020549 7:147637215-147637237 CCTCACATCTACACTCAACACGG - Intronic
1034303996 7:150036796-150036818 CCTAACACCCACAGTCCTCCAGG + Intergenic
1034304514 7:150038692-150038714 CCTAACACCCACAGTCCTCCAGG + Intergenic
1036104509 8:5825470-5825492 CCTGGCACCCACCTTCATCAGGG - Intergenic
1045364093 8:101459713-101459735 CCTGATATCCACACTGATCTTGG + Intergenic
1048197530 8:132344593-132344615 CCAGAGTCACACACTCATCACGG + Intronic
1048464744 8:134656079-134656101 TGTGACACCCACACTCTCCATGG - Intronic
1049326244 8:142022990-142023012 GCTGACACCCACCCCCACCATGG - Intergenic
1049562278 8:143317691-143317713 CCCCACACCCACACTCAGCGCGG - Intronic
1049578234 8:143399291-143399313 CCTGACACCCCCAACCCTCACGG - Intergenic
1051488353 9:17633236-17633258 GCAGGTACCCACACTCATCATGG - Intronic
1051669714 9:19497207-19497229 CCTGACACCCATGTGCATCACGG + Intergenic
1056103755 9:83326560-83326582 CCTGAGGCCCAGACTCACCAAGG + Intronic
1057585780 9:96327458-96327480 CTAGTCACCCACACTCATGATGG - Intronic
1057938110 9:99257684-99257706 CTTCTCACCCACACTCCTCATGG - Intergenic
1060801538 9:126548601-126548623 ACTGTCACCCACATTCAGCAGGG + Intergenic
1061676320 9:132217946-132217968 CACATCACCCACACTCATCACGG - Intronic
1062053921 9:134461044-134461066 GCTGACAGCCACACCCATCCAGG - Intergenic
1062159981 9:135074865-135074887 GCTGACCTCCCCACTCATCAGGG + Intergenic
1185592083 X:1283957-1283979 CCTGACACCCTCAGTCAAGAGGG - Intronic
1185909002 X:3965363-3965385 CTTGAAACCCACACTCAGAAAGG - Intergenic
1187637853 X:21252062-21252084 GTTGACTCCCACACTCACCAAGG + Intergenic
1193269908 X:79516592-79516614 CCATTCAGCCACACTCATCATGG + Intergenic
1197888164 X:131239586-131239608 CCTGACACTCACACCCACCATGG - Intergenic
1200216119 X:154368945-154368967 CCTGACACCCCCCATCACCATGG + Intronic