ID: 1175543241

View in Genome Browser
Species Human (GRCh38)
Location 20:59761381-59761403
Sequence CAGCTTGGGCAGCTGGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 281}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175543241_1175543251 4 Left 1175543241 20:59761381-59761403 CCCACAGCCAGCTGCCCAAGCTG 0: 1
1: 0
2: 4
3: 31
4: 281
Right 1175543251 20:59761408-59761430 CAAGGTTGTGCTGGGTGTACGGG 0: 1
1: 0
2: 0
3: 78
4: 1238
1175543241_1175543250 3 Left 1175543241 20:59761381-59761403 CCCACAGCCAGCTGCCCAAGCTG 0: 1
1: 0
2: 4
3: 31
4: 281
Right 1175543250 20:59761407-59761429 CCAAGGTTGTGCTGGGTGTACGG 0: 1
1: 0
2: 2
3: 23
4: 179
1175543241_1175543255 26 Left 1175543241 20:59761381-59761403 CCCACAGCCAGCTGCCCAAGCTG 0: 1
1: 0
2: 4
3: 31
4: 281
Right 1175543255 20:59761430-59761452 GGGTGGAGTACAAGTGACCATGG 0: 1
1: 0
2: 0
3: 9
4: 112
1175543241_1175543252 5 Left 1175543241 20:59761381-59761403 CCCACAGCCAGCTGCCCAAGCTG 0: 1
1: 0
2: 4
3: 31
4: 281
Right 1175543252 20:59761409-59761431 AAGGTTGTGCTGGGTGTACGGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1175543241_1175543254 9 Left 1175543241 20:59761381-59761403 CCCACAGCCAGCTGCCCAAGCTG 0: 1
1: 0
2: 4
3: 31
4: 281
Right 1175543254 20:59761413-59761435 TTGTGCTGGGTGTACGGGGGTGG 0: 1
1: 0
2: 0
3: 19
4: 201
1175543241_1175543253 6 Left 1175543241 20:59761381-59761403 CCCACAGCCAGCTGCCCAAGCTG 0: 1
1: 0
2: 4
3: 31
4: 281
Right 1175543253 20:59761410-59761432 AGGTTGTGCTGGGTGTACGGGGG 0: 1
1: 0
2: 0
3: 5
4: 115
1175543241_1175543247 -5 Left 1175543241 20:59761381-59761403 CCCACAGCCAGCTGCCCAAGCTG 0: 1
1: 0
2: 4
3: 31
4: 281
Right 1175543247 20:59761399-59761421 AGCTGAGACCAAGGTTGTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 158
1175543241_1175543248 -4 Left 1175543241 20:59761381-59761403 CCCACAGCCAGCTGCCCAAGCTG 0: 1
1: 0
2: 4
3: 31
4: 281
Right 1175543248 20:59761400-59761422 GCTGAGACCAAGGTTGTGCTGGG 0: 1
1: 0
2: 1
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175543241 Original CRISPR CAGCTTGGGCAGCTGGCTGT GGG (reversed) Intronic
900396594 1:2455584-2455606 TAGCTGGAGCAGCTGCCTGTGGG + Intronic
900865573 1:5266473-5266495 CAGCTTGGGGAGCAGGGAGTTGG - Intergenic
901056533 1:6451056-6451078 CTGCTTGTGCATCTGTCTGTGGG + Intronic
901154100 1:7123888-7123910 CAGCCAGGGGAGGTGGCTGTGGG + Intronic
901660233 1:10794582-10794604 CAGCTTGGAAAGCCGGCTCTGGG - Intronic
901701385 1:11046505-11046527 CAGTCTGCGCAGCTGGCTGTGGG - Intronic
901748878 1:11393729-11393751 CAGCATGGGCATCAGGTTGTGGG - Intergenic
902357432 1:15915307-15915329 CAGCCTGGGCAACAGGCTGGGGG + Intronic
902448756 1:16483988-16484010 GTGCTTGGGCAGCTGGGGGTGGG - Intergenic
902468136 1:16630661-16630683 GTGCTTGGGCAGCTGGGGGTGGG - Intergenic
902506023 1:16939368-16939390 GTGCTTGGGCAGCTGGGGGTGGG + Intronic
903155006 1:21437027-21437049 GTGCTTGGGCAGCTGGGGGTGGG + Intergenic
903193885 1:21670890-21670912 CAGCTAGGGAAGCTTGCTGGAGG - Intergenic
903271345 1:22190334-22190356 CAGCCTTGGCAGCTGGCCCTGGG + Intergenic
906129621 1:43448305-43448327 CAGCTGGTGCGGCTGGCTGGAGG + Exonic
909124950 1:71656144-71656166 CAGATTGGGAAGTGGGCTGTGGG - Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
911853841 1:102853247-102853269 CAGGTTGGGCAGCAGCCTGCAGG + Intergenic
912124781 1:106522557-106522579 CACCTTGGGCAGATGTCTTTCGG - Intergenic
914247209 1:145895335-145895357 CACCTTGGGCAGCTGGCAAAGGG - Exonic
915431246 1:155868628-155868650 CAGGTCCTGCAGCTGGCTGTAGG - Exonic
917732649 1:177891650-177891672 CAGGTTGCCAAGCTGGCTGTGGG - Intergenic
917969037 1:180195616-180195638 CTGCTGGGGCTGCAGGCTGTTGG - Intronic
920738556 1:208558305-208558327 CCACTTGAGCAGCTGCCTGTGGG - Intergenic
922286523 1:224175601-224175623 CAGCTTTGGCAGCAGCCTTTTGG + Intergenic
923273736 1:232379381-232379403 CAGCCTGGGCAGCTGGGAGATGG - Intergenic
923378173 1:233387696-233387718 CAGCCAGGGCTGCTGTCTGTGGG + Intergenic
923475198 1:234325302-234325324 CAGCTGGGGCAGCAGGATGCTGG + Intergenic
923746626 1:236706967-236706989 CAGCCTGGGAAGCCGGTTGTGGG + Intronic
1064553185 10:16522195-16522217 CAACTGGGGCTGCTGGCAGTGGG - Intergenic
1066008471 10:31170401-31170423 CTGCTTTTCCAGCTGGCTGTCGG - Intergenic
1067697016 10:48542829-48542851 CAGGTGGGGTAGCAGGCTGTCGG + Intronic
1067942360 10:50667747-50667769 CAGCTTGGGAAGCAGGTGGTAGG - Intergenic
1068137112 10:52961613-52961635 CAGCTTGGTCAGCTGCGTGGAGG - Intergenic
1069832138 10:71287887-71287909 CAGCCTGGGCAGCCGGCTGTGGG - Intronic
1072924145 10:99601213-99601235 CAGCCTGGGCATCTGTCTATAGG - Intergenic
1073102808 10:101015744-101015766 CACATTAGGCAGCTGGCTGGAGG + Intronic
1073448226 10:103593454-103593476 CAGCTAGGCCTGCTGGATGTGGG + Intergenic
1074116629 10:110461210-110461232 CATCTTGGGCAGGTGGCTCCAGG + Intergenic
1076664597 10:132079079-132079101 AGGCCTCGGCAGCTGGCTGTGGG - Intergenic
1077117031 11:889846-889868 CAGCTGTGGCCGCTGGCTGCTGG - Intronic
1078511187 11:11985328-11985350 GAGCTTGGGGAGCTCACTGTCGG - Intronic
1079867604 11:25756217-25756239 CAGCTGGCACTGCTGGCTGTGGG + Intergenic
1080396862 11:31898269-31898291 CTGCTTGCTCAGCTGGGTGTAGG + Intronic
1081977224 11:47243254-47243276 CAGCTTGGGGAGCTGGGAGGTGG + Exonic
1082975042 11:59062950-59062972 CAGCTTGGGCAGCGCGCTGGCGG - Intergenic
1083049237 11:59762294-59762316 GTGCCTGGGCAGCTGGCTGCCGG - Intronic
1083635132 11:64116788-64116810 CAGCTTGAGCTGTTTGCTGTCGG - Exonic
1083721803 11:64607157-64607179 CAGGAGGGGCAGCTGGCAGTGGG + Exonic
1084889104 11:72228055-72228077 CAGCCTGGGCAGGTGGTTTTAGG + Intronic
1088460898 11:110081584-110081606 CAGATTGGTCAGCAGCCTGTAGG + Intergenic
1088894037 11:114064459-114064481 AAGCTGGGGGAGCTGGCTGTGGG + Exonic
1091281890 11:134386445-134386467 GAGCTGGGGCAGCCAGCTGTGGG + Intronic
1091306006 11:134536430-134536452 CAGCGTGGGCAGGGTGCTGTGGG + Intergenic
1091556133 12:1574717-1574739 CTGCTTGAACAGCTGGATGTGGG + Intronic
1092122895 12:6056987-6057009 CAGGTAGGGCAGCGGGCTGACGG + Exonic
1095665186 12:44788987-44789009 CTCCTTGGGCAGGTTGCTGTGGG - Intronic
1097072286 12:56363912-56363934 CAGGATGGGCAGCTGGGTGCTGG + Intergenic
1098029196 12:66236876-66236898 CAGAGTGGGCAGGTGGCTGGAGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1098445067 12:70558008-70558030 CAACTACTGCAGCTGGCTGTGGG + Intronic
1100599430 12:96100198-96100220 CAGCCTTTGCAGCTGGCTGCTGG + Intergenic
1100770185 12:97913132-97913154 CAGCTTGGGCAGCTGACCAAAGG + Intergenic
1102203473 12:111074552-111074574 CAGCTTGGACAGGGGGCTGAGGG + Intronic
1102278180 12:111598773-111598795 CGGCCTGGGCAGGTGGGTGTCGG - Exonic
1103600450 12:122051266-122051288 CAGCTCGGGCAGCAGGCAGGTGG - Intronic
1103922633 12:124407060-124407082 GAGGTAGGGCACCTGGCTGTAGG - Intronic
1104024834 12:125018147-125018169 CAGCAGGGGAAGCTGGCTCTGGG - Intronic
1104594165 12:130108973-130108995 CAGCTGGGGTTGCTGGCTGGAGG - Intergenic
1104750131 12:131233117-131233139 CAGCCTGGGCAGCTGGCACGGGG - Intergenic
1104769303 12:131351090-131351112 CAGCATGGGCATCTGAATGTGGG - Intergenic
1104782585 12:131431344-131431366 CAGCCTGGGCAGCTGGCACGGGG + Intergenic
1105474540 13:20719052-20719074 CAGCATGGGCAGGTGTGTGTGGG - Intronic
1107934038 13:45329872-45329894 CAGCTCAGGCAGCTGGCTTGTGG - Intergenic
1111540980 13:89666998-89667020 TAGCTTGGCCTGCTGCCTGTCGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1117069288 14:52042192-52042214 GGGCCTGGGCTGCTGGCTGTGGG + Exonic
1118862336 14:69674189-69674211 CAGCCTGTGAAGCTGGCAGTGGG - Intronic
1120667354 14:87322464-87322486 CAGCTTGGGCAACTGGTGGATGG + Intergenic
1120896190 14:89534563-89534585 CAGCTAGGGCAGTTTGCCGTAGG - Intronic
1121225049 14:92315612-92315634 CAGCTCGGGCAGCTGTCTGCAGG - Intergenic
1122274796 14:100586068-100586090 CAGCAGGGGCAACTGGCCGTTGG - Intronic
1122793067 14:104192578-104192600 CAGCTGGAGCAGCTGGGTGGTGG + Intergenic
1123937103 15:25199315-25199337 CAGGGTGGGCACCTGGCTGATGG - Intergenic
1124240567 15:28024570-28024592 AAGGTCGGGTAGCTGGCTGTGGG - Intronic
1126143526 15:45456267-45456289 CAGTCTGGGCAGCAGGTTGTGGG + Intergenic
1127819003 15:62638956-62638978 TAGCTTGGTCTGCTGGATGTTGG + Intronic
1128313765 15:66647432-66647454 CAGCCTGGGGAGCTGGCGGCAGG - Intronic
1129618203 15:77117569-77117591 CTGCTGTGGCAGGTGGCTGTCGG - Intronic
1129815506 15:78549422-78549444 CAGCTTGAGCTGCTGCCTGTGGG - Exonic
1131114148 15:89783944-89783966 CAGCCTGCGGAGCTGGCTGTGGG + Intergenic
1131782240 15:95872174-95872196 CAGGTTGCGCTGCTGGCTGTGGG + Intergenic
1133221277 16:4320166-4320188 CAGCCTTGGCAGATGGCTGCCGG + Intronic
1133312801 16:4861139-4861161 CAGTTTGGGCAGATTGCTGTTGG + Intronic
1133483917 16:6199958-6199980 AACCTTGGATAGCTGGCTGTCGG - Intronic
1137732618 16:50699749-50699771 CAGCTTGGGGGACTGGCTGTCGG - Exonic
1138067603 16:53958403-53958425 CAGCCTGGGAAGCTGGCGGCCGG + Intronic
1138197344 16:55061302-55061324 CATGTTGGGCAGCTGGCCCTGGG + Intergenic
1138217987 16:55222293-55222315 CAGCCAGAGCAGCTGGCTGCTGG - Intergenic
1140650430 16:77082380-77082402 AAGCTTTGTCAGCTGGGTGTGGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1142289956 16:89189402-89189424 CAGCATGGGCATCTGTGTGTGGG - Intronic
1142605292 17:1078045-1078067 CAGCTCCCGCAGCTGGCTGGGGG - Intronic
1143099950 17:4499332-4499354 CAGCTTGGGCCGCGGGCGGGGGG + Exonic
1143715227 17:8763038-8763060 CAGCCTGGGCACCTCGCTATTGG - Intergenic
1144667404 17:17111486-17111508 CAGCCTGGGCACCTGCCTGCTGG + Intronic
1146066769 17:29642195-29642217 CACATTGGTCAGCTGGCAGTAGG - Intronic
1147130459 17:38404852-38404874 CACTTTGGGTAGCTGGCTGTTGG + Exonic
1147188600 17:38726062-38726084 CAGCTCGGGCAGATGGCAGAAGG + Exonic
1147605177 17:41770352-41770374 CTGCTTGGGCACCTACCTGTGGG - Intronic
1148443155 17:47722097-47722119 CAGCTTGGATGGCTGGCAGTGGG + Intergenic
1148550439 17:48547078-48547100 CAGCTTCTGTAGCTGGCTGAAGG + Intergenic
1148834909 17:50460945-50460967 GAGCGTGGGCACCTGGCTATGGG + Intronic
1151437207 17:74105193-74105215 CAGCTTGACCAGGTGGCTGTTGG - Intergenic
1151620604 17:75242712-75242734 CAGGTAGGGCAGCTGGCAGCAGG + Intronic
1152086779 17:78224764-78224786 CTGTCTGGGCAGATGGCTGTTGG - Exonic
1152230743 17:79112884-79112906 CAACCTGGGCAGCAGGCTCTCGG + Intronic
1152608261 17:81303654-81303676 TACCTTGGCCAGCTGGCTGCAGG - Intergenic
1152669471 17:81593805-81593827 CAGCTGGGGCATCAGGCAGTGGG - Intronic
1154315308 18:13299408-13299430 AAGCCTGAGCAGCTGGCTGCAGG + Intronic
1155158485 18:23177504-23177526 CAGCTTGTCCACTTGGCTGTTGG + Intronic
1156545823 18:37962736-37962758 GACCTTGGGCAGATTGCTGTAGG + Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1160016338 18:75143604-75143626 CAGCTAGCTGAGCTGGCTGTTGG + Intergenic
1160325407 18:77942430-77942452 CAGCTTGCACAGTTGGGTGTTGG + Intergenic
1160454771 18:78992752-78992774 CAGCCCGGGCAGCTGGCTGGGGG - Exonic
1161658312 19:5529690-5529712 CTCCCTGGCCAGCTGGCTGTGGG - Intergenic
1161768293 19:6218545-6218567 TGTCTTGGGCAGCTGGCGGTAGG - Intronic
1162141120 19:8586157-8586179 CCTTTTGGGCAGCTTGCTGTGGG + Exonic
1162764900 19:12913132-12913154 CGGATTGGGCAGCGGGCTGGGGG + Intronic
1163993417 19:21020889-21020911 CAGATTGTGCAGCTGACTGCCGG - Intronic
1164141181 19:22465896-22465918 CAGCTTGGTCACCAGGCTGCTGG + Intronic
1164967585 19:32498886-32498908 AAACATGGGCAGCTGGCTGTGGG - Intergenic
1165325393 19:35111663-35111685 GGGCTTGGGCAGATGGCTGGGGG - Intergenic
1166913320 19:46176785-46176807 CAGCATGGGCAACAGGCTGGGGG - Intergenic
925025378 2:602833-602855 CAGCTTGGCCACATGGCTGGAGG + Intergenic
925165960 2:1715895-1715917 CACATTGGGCAGCTGGGTGAGGG - Intronic
925214541 2:2083396-2083418 CAGCTGTGACAGCGGGCTGTGGG - Intronic
925290919 2:2748246-2748268 CAGGGTGGGCTGCAGGCTGTGGG - Intergenic
925870404 2:8265190-8265212 CAGCTTTGGAGGCTGGCTGGTGG + Intergenic
926712026 2:15889561-15889583 CAGCTGGGGCAGCTCTCTGATGG + Intergenic
926749370 2:16186235-16186257 CAGCTGGAGCACCTGGCTGGGGG + Intergenic
927471930 2:23384058-23384080 TAGTGTGGGGAGCTGGCTGTGGG - Intergenic
927894218 2:26771151-26771173 CTTCTTGGGGAGCTGACTGTAGG - Intronic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
928668281 2:33573885-33573907 CAGCCTGGGCAGCAGGCTGGTGG + Intergenic
928880568 2:36092340-36092362 CAGCTGGCACTGCTGGCTGTGGG + Intergenic
929979312 2:46663946-46663968 GTGCTTAGGCACCTGGCTGTGGG - Intergenic
931296987 2:60937044-60937066 CAGATGGGCCAGATGGCTGTGGG - Intergenic
932743744 2:74313884-74313906 CACCTAGGGCAGCTGCCTCTTGG - Intronic
933824615 2:86147761-86147783 CAGTGTGGGCAGCTGCCTGTCGG + Exonic
934925170 2:98377191-98377213 CTGCCTGGGCAGCTGTTTGTGGG - Intronic
935581631 2:104760841-104760863 TAGCTTGTGCAGCTGGCTGTGGG + Intergenic
935634566 2:105240193-105240215 CACCCTGGACATCTGGCTGTTGG - Intergenic
937151076 2:119686072-119686094 CAGAGTGGGCAGCCAGCTGTGGG + Intronic
937865480 2:126748369-126748391 CAGCCTGAGGAGCTGTCTGTGGG - Intergenic
938112714 2:128579716-128579738 CAGGTTGGGCAGCTGGGCGATGG - Intergenic
939643641 2:144670265-144670287 CAGCTTGGGCAGGAGGCAGGGGG - Intergenic
940705902 2:157104819-157104841 AAGCATGGGCTGTTGGCTGTGGG - Intergenic
941053898 2:160765993-160766015 CACCTGTGGCAGCTGCCTGTGGG + Intergenic
942246728 2:174014816-174014838 CACCATGAGCAGCTGGCAGTTGG + Intergenic
944667992 2:201972702-201972724 CAGCTTCGGGAGCAGGCTGTTGG - Intergenic
944669511 2:201983604-201983626 CAGCCTGGGGAGCTGGCTTCAGG + Intergenic
945791389 2:214309871-214309893 CAGCTGGGACAGCAGGTTGTGGG + Intronic
948161719 2:235830065-235830087 GAGCTTTGGCGGCTGGCTGATGG + Intronic
948486530 2:238284947-238284969 CAGCTGGTCCAGCTGGCTATGGG - Intronic
948674656 2:239589772-239589794 CAGGCTGGGGAGCTGGCTGAAGG + Intergenic
948674671 2:239589833-239589855 CAGGCTGGGGAGCTGGCTGAAGG + Intergenic
948674686 2:239589894-239589916 CAGGCTGGGGAGCTGGCTGAAGG + Intergenic
948876865 2:240834076-240834098 GAGCTGGGGCAGATGTCTGTGGG - Intergenic
948876883 2:240834133-240834155 GAGCCTGGGCAGGTGTCTGTGGG - Intergenic
949003647 2:241632987-241633009 TAGCTTCCGCACCTGGCTGTCGG + Exonic
1168977749 20:1980794-1980816 GAGCTTGGCCAGCTCACTGTAGG + Exonic
1170665584 20:18383146-18383168 TAGACTGGGCAGCTGTCTGTGGG - Intergenic
1173784392 20:45782198-45782220 CAGCTTGAGCAGTTGGGTGATGG - Intronic
1174418699 20:50385238-50385260 CAGATTGGGCAGCTGCATGGAGG - Intergenic
1175543241 20:59761381-59761403 CAGCTTGGGCAGCTGGCTGTGGG - Intronic
1180160880 21:45998192-45998214 CAGCTTGGGCATGTTCCTGTGGG - Intronic
1181104411 22:20565223-20565245 GGGCTTGGGCATCTGGCGGTGGG + Intronic
1181491356 22:23262657-23262679 CAGCCAGGGCCGCTGGGTGTGGG + Intronic
1182752330 22:32651702-32651724 CAGTTTGGGAAGCAGGGTGTAGG - Intronic
1185074488 22:48676001-48676023 CTGCTGAGGCAGCTGGCGGTGGG + Intronic
949465283 3:4337349-4337371 GAGGCTGGGCAGCTGGCTGCAGG - Intronic
949942045 3:9162652-9162674 CAGCGTGGGGAGCTGGCCATGGG + Intronic
949987467 3:9552466-9552488 CTGCGTGGGCAGCGGGCTGGCGG - Exonic
950140424 3:10611366-10611388 GAGCTTGGGCAGAGGGGTGTGGG + Intronic
950589912 3:13929701-13929723 CAGCAGGGGCAGCTGGCCCTAGG - Intergenic
950850197 3:16054932-16054954 CAGCTGGGGCTGCTGGTTGGAGG - Intergenic
951466054 3:23001372-23001394 GAGCTAGGGCTGCAGGCTGTGGG - Intergenic
952035796 3:29199194-29199216 CTGCCTCTGCAGCTGGCTGTTGG - Intergenic
952776766 3:37053899-37053921 CCGCTTGGCCAGGTGGCTGTTGG + Exonic
952986902 3:38793813-38793835 GAACTTGGGCAGCTGGTTGCAGG + Exonic
953666450 3:44929474-44929496 GAGCCTGGGCAGCAGGCAGTGGG - Intronic
954455800 3:50599252-50599274 TACCTGGGGCAGCTGGCAGTGGG - Intergenic
954624191 3:52013591-52013613 GAGCTGGGGCAGCTGCCTGTTGG + Intergenic
956308759 3:67855842-67855864 CAGCTGGGGCAGCTTGTTGAAGG + Intergenic
959562843 3:107802209-107802231 CAGCTTGTGTAGCCAGCTGTAGG + Intronic
960359479 3:116694138-116694160 TTGCTTGGGCAGCTGGCTGGAGG - Intronic
961440818 3:126952281-126952303 CAGCTGGACCAGCTGGGTGTTGG + Intronic
961637341 3:128341825-128341847 CAGCCTGGGCAGGAAGCTGTCGG - Exonic
962233903 3:133692044-133692066 CCGCTGGTGCTGCTGGCTGTAGG + Intergenic
964380838 3:156097645-156097667 CAGCTTTGGCAGCTGAAGGTGGG + Intronic
967703364 3:192620534-192620556 AAGCTTGGGCAGCAGGTTGGTGG - Intronic
967709443 3:192688048-192688070 CAGCTGTGGCGGCTGGCTGAAGG - Intronic
968679283 4:1905564-1905586 CAGGCTTGTCAGCTGGCTGTGGG + Intronic
968866726 4:3217672-3217694 CAGCTTGAGCAGCTGGTTGTAGG + Intronic
968977176 4:3828012-3828034 CTGCTCGGGAAGCTGGCTGCAGG + Intergenic
969314843 4:6375692-6375714 CTGGTTGGGCTGCTGGCTGCTGG - Intronic
969614655 4:8245212-8245234 CGGCCTGGGGAGCAGGCTGTGGG + Intergenic
971214006 4:24647032-24647054 CTTCTGGGGCAGCTGGCTGTGGG + Intergenic
976709625 4:88055160-88055182 CAGGCAGGGCAGCTGGCTGCAGG + Intronic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
978484504 4:109235902-109235924 CAGATTGGGCAGTTAGCTCTAGG + Intronic
980088442 4:128416429-128416451 CAGCATGGGCAGGAAGCTGTGGG + Intergenic
980218472 4:129881998-129882020 CAGCTTAGAAACCTGGCTGTTGG - Intergenic
983664705 4:170167894-170167916 CAGCTTGGCCGCTTGGCTGTGGG + Intergenic
984762776 4:183376876-183376898 CAGCTGAGGCATCTGGCAGTGGG - Intergenic
985040530 4:185887074-185887096 CAGCCTGGGCAGCTGTCTGCGGG + Intronic
986064133 5:4219460-4219482 CAGCTCAGGCATGTGGCTGTTGG + Intergenic
986943118 5:12980950-12980972 CAGATTGTTAAGCTGGCTGTGGG + Intergenic
987332171 5:16866939-16866961 CAGGTCGGGCAGCTGGCAGGAGG - Intronic
987951841 5:24686641-24686663 CAGCTTCCACAGCTGGCTCTGGG + Intergenic
989507399 5:42243294-42243316 GAGCTTGGAAAGCTGCCTGTTGG + Intergenic
992791930 5:80221324-80221346 GAGCGAGGGCAGCTGGCTGTTGG - Intronic
992827233 5:80562526-80562548 AAGCTGGGGAAGCAGGCTGTGGG - Intronic
993236044 5:85311651-85311673 CAGCTTTGACAGCTGGCACTGGG - Intergenic
993600922 5:89924094-89924116 CAGCTTGGGCAGGTAGATATTGG - Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997329401 5:133048180-133048202 CAGGTTGCGCTGCTGGTTGTTGG - Intergenic
997694346 5:135849744-135849766 CAGCAGGGGCAGCTGGCTGGAGG + Intronic
998079507 5:139262836-139262858 CAGCTTAGGAAACTGGCTGATGG + Intronic
998417354 5:141955557-141955579 CCTCTTGGGCTGCTGGCGGTAGG + Exonic
998674811 5:144395527-144395549 CAGCTGGGCCAGCTGCCTGCAGG + Intronic
998821222 5:146059815-146059837 CAGCAGGGGCGGCTGGCAGTAGG - Intronic
1001308868 5:170596342-170596364 CATCATGGGCAGCTGCCTCTTGG + Intronic
1001933705 5:175690180-175690202 CAGCTGGGGCCCCTGACTGTGGG - Intergenic
1003191574 6:3879662-3879684 CAGTTTCGGGAGCTGGATGTGGG - Intergenic
1003312170 6:4979044-4979066 CAGCATGAGCAGCAGTCTGTAGG - Intergenic
1003438750 6:6120660-6120682 CAGCATAGGCAGGTAGCTGTGGG + Intergenic
1004173896 6:13322040-13322062 CAGCCTGGGCAACTGGGTGAAGG + Intronic
1006457851 6:34142312-34142334 CAGCTGGGCCTGCCGGCTGTTGG - Intronic
1008562046 6:52733269-52733291 CAGGTGGGGCAGGAGGCTGTGGG + Intergenic
1015053019 6:128864486-128864508 CATCATGGGAAGCTGGCTGCAGG + Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1016409461 6:143766697-143766719 CAGCTTGGGCAACTGGGTGGTGG - Intronic
1016548306 6:145248647-145248669 CTGCTTGGGGAGCTCTCTGTGGG - Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019051154 6:169185049-169185071 CAGCTGGGCCTGCCGGCTGTGGG - Intergenic
1019089958 6:169520212-169520234 CAGTGTGGGAAGCTGGCTATGGG - Intronic
1019660833 7:2223204-2223226 CAGCGTGGACAGGAGGCTGTGGG + Intronic
1023132464 7:37016444-37016466 CTGCTGGGTCAGCTGACTGTGGG - Intronic
1023983649 7:45083152-45083174 CAGCTTCTGCAGCTGGCTGTGGG + Exonic
1024812188 7:53225129-53225151 CATCTTGGTCAGCTTGCTCTAGG + Intergenic
1025190057 7:56889488-56889510 CAGCTTGGAAACCTGGCTGGGGG + Intergenic
1025252289 7:57359728-57359750 CAGATTGGGCAGCTGCATGGAGG + Intergenic
1025681883 7:63687433-63687455 CAGCTTGGAAACCTGGCTGGGGG - Intergenic
1026106266 7:67423244-67423266 ATCCATGGGCAGCTGGCTGTGGG - Intergenic
1026968021 7:74452943-74452965 CAGTTTGGCCAGGAGGCTGTGGG + Intergenic
1029287433 7:99475512-99475534 CAGCAGGTGGAGCTGGCTGTAGG + Intronic
1031992320 7:128206457-128206479 CAGCGCGGAAAGCTGGCTGTGGG + Intergenic
1032006167 7:128303594-128303616 CACCTGGAGCAGCTGCCTGTGGG - Exonic
1032469148 7:132165421-132165443 CATTTTGGGCAGCAGGCTGTGGG + Intronic
1032790389 7:135238281-135238303 CAGCTTGGCCAGCATGCTCTGGG + Intronic
1034863740 7:154622791-154622813 CAGCCAGGGCAGCCTGCTGTGGG + Intronic
1035581198 8:739823-739845 CAGCATGTGGAGCAGGCTGTAGG + Intergenic
1036609801 8:10339979-10340001 CAGCTAGGGCAGCTGCCTTGGGG - Intronic
1037492039 8:19405849-19405871 CAGCATGCCCAGCTGGCCGTGGG + Exonic
1038147943 8:24915058-24915080 CAGCTGGGGCAGGTGGGTGGGGG - Intronic
1039356383 8:36821410-36821432 CATCATGGTAAGCTGGCTGTTGG + Intronic
1041296519 8:56362632-56362654 CAGCATGGGCAAGAGGCTGTGGG + Intergenic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042775313 8:72424215-72424237 CAGCTTGTTCACCTGGTTGTTGG - Intergenic
1045319612 8:101072025-101072047 CAGCTGGGGCAGCAGGCAGAGGG - Intergenic
1045335626 8:101201636-101201658 CAGCTTTGGCAGCAGCCTTTTGG + Exonic
1046131978 8:109976411-109976433 TAGCTTTGCCAACTGGCTGTGGG + Intergenic
1047399328 8:124532760-124532782 CAGATCGGGCAGTTGGCTGGGGG + Intronic
1048068724 8:130999641-130999663 CAGCTTGGGCTGCAGACTGTGGG - Intronic
1049431598 8:142567731-142567753 GAGCCTGGGCTGGTGGCTGTGGG - Intergenic
1049478721 8:142809982-142810004 AAGCCAGGGCAGCTGGCAGTAGG - Intergenic
1049603925 8:143520416-143520438 CAGGGTGGGCAGCTGGCCATCGG - Intronic
1049662882 8:143828277-143828299 CAGCTTGGGCAAATGGCTGAAGG - Intronic
1052758632 9:32567170-32567192 CAGCTTGAGCAGCTGGCCAGCGG - Exonic
1052963276 9:34318945-34318967 GACCTTGGGCAGCTTGCCGTCGG - Intronic
1053462098 9:38279002-38279024 TAGCCTGGGCAGGTGGCTGAAGG - Intergenic
1056216732 9:84412075-84412097 CAGGTTTGGCAGGTGCCTGTTGG - Intergenic
1056601811 9:88052766-88052788 CAGCTGTGGCAGCTGGGGGTGGG - Intergenic
1057268158 9:93632231-93632253 CTCCCTGGGCAGCTGGCCGTAGG - Intronic
1058170189 9:101670953-101670975 CCGCTTGGGCAGCTGGCAGGGGG - Exonic
1059270600 9:113068252-113068274 CTGCGTGGCCAGCTGGGTGTGGG + Intergenic
1059271733 9:113073699-113073721 CTGCGTGGCCAGCTGGGTGTGGG + Intergenic
1059272867 9:113079146-113079168 CTGCGTGGCCAGCTGGGTGTGGG + Intergenic
1059274002 9:113084588-113084610 CTGCGTGGCCAGCTGGGTGTGGG + Intergenic
1059275136 9:113090032-113090054 CTGCGTGGCCAGCTGGGTGTGGG + Intergenic
1059788831 9:117617596-117617618 CTGCTTGGGCTCCAGGCTGTTGG + Intergenic
1060010702 9:120040781-120040803 CTGCTTGGACATCGGGCTGTGGG - Intergenic
1060155097 9:121313995-121314017 GAGCTTGGCCAGCTTGCGGTTGG - Exonic
1061192382 9:129089282-129089304 CGGCATGGGCACCTGGGTGTGGG + Exonic
1061622622 9:131821510-131821532 CAGCTTGGGCACCTGGGAGGGGG - Intergenic
1061668575 9:132175006-132175028 CAGCCTGTGCCTCTGGCTGTGGG - Intronic
1061930478 9:133830215-133830237 CATGTTGGGCATCTGGCTATGGG + Intronic
1062052826 9:134456300-134456322 CAGCTGGGGCAGCAGGCTCCAGG - Intergenic
1062082083 9:134629558-134629580 CAGCTGGGGCAGTTGGGTCTGGG + Intergenic
1062358314 9:136175484-136175506 CAGCTGGGGCAGCTCTCTGGGGG + Intergenic
1187850738 X:23589355-23589377 CAGCGTGGGCTGGTGGCTGATGG - Intergenic
1188284770 X:28314299-28314321 AAGCTGTGACAGCTGGCTGTTGG + Intergenic
1192747294 X:73951691-73951713 CAGCCTGGGCAACTGGGTGAGGG + Intergenic
1195214322 X:102683436-102683458 CACCTTGGGCAGGTGGGTGGTGG + Intergenic
1195236637 X:102905893-102905915 CAGCATGGGGAGCTGGATTTGGG + Intergenic
1196020322 X:110984477-110984499 CAGCTGAGGCAGCTGGAAGTGGG - Intronic
1197683737 X:129415865-129415887 TAACTTGGGCAGGTGGCTGGAGG + Intergenic
1198362454 X:135908950-135908972 CAGCTTGGTCATATGGCTGCAGG + Exonic
1200052758 X:153443693-153443715 CAGATTGTCCAGCTGGCTGGAGG + Intergenic
1200243026 X:154507651-154507673 CAGCTTGGTCTGGAGGCTGTGGG - Intronic
1200292627 X:154886880-154886902 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200339471 X:155382620-155382642 CAGCTGGGGCAGCTGGAGCTGGG - Exonic
1200346999 X:155458073-155458095 CAGCTGGGGCAGCTGGAGCTGGG + Exonic
1200411674 Y:2867829-2867851 CAGCTTCCACAGCTGGCTCTGGG + Intronic