ID: 1175543738 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:59764398-59764420 |
| Sequence | TCCTCTGACTCATCTCCTCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1175543738_1175543739 | 14 | Left | 1175543738 | 20:59764398-59764420 | CCTGGAGGAGATGAGTCAGAGGA | No data | ||
| Right | 1175543739 | 20:59764435-59764457 | TAGACAAACCTTCCCCACCATGG | No data | ||||
| 1175543738_1175543741 | 25 | Left | 1175543738 | 20:59764398-59764420 | CCTGGAGGAGATGAGTCAGAGGA | No data | ||
| Right | 1175543741 | 20:59764446-59764468 | TCCCCACCATGGTTTCATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1175543738 | Original CRISPR | TCCTCTGACTCATCTCCTCC AGG (reversed) | Intronic | ||