ID: 1175543741 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:59764446-59764468 |
Sequence | TCCCCACCATGGTTTCATGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1175543738_1175543741 | 25 | Left | 1175543738 | 20:59764398-59764420 | CCTGGAGGAGATGAGTCAGAGGA | No data | ||
Right | 1175543741 | 20:59764446-59764468 | TCCCCACCATGGTTTCATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1175543741 | Original CRISPR | TCCCCACCATGGTTTCATGT TGG | Intronic | ||