ID: 1175543741

View in Genome Browser
Species Human (GRCh38)
Location 20:59764446-59764468
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175543738_1175543741 25 Left 1175543738 20:59764398-59764420 CCTGGAGGAGATGAGTCAGAGGA No data
Right 1175543741 20:59764446-59764468 TCCCCACCATGGTTTCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type