ID: 1175547162

View in Genome Browser
Species Human (GRCh38)
Location 20:59785839-59785861
Sequence CAGGGGATGCAGAGGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 585}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175547162_1175547171 13 Left 1175547162 20:59785839-59785861 CCAGCAGCCCTCTGCATCCCCTG 0: 1
1: 0
2: 7
3: 66
4: 585
Right 1175547171 20:59785875-59785897 TACTTCATTTTGTTTTCCAACGG 0: 1
1: 1
2: 1
3: 69
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175547162 Original CRISPR CAGGGGATGCAGAGGGCTGC TGG (reversed) Intronic
900551146 1:3256252-3256274 CAGGGGCTGCTGCGGGCTGGGGG + Intronic
900590699 1:3458255-3458277 CAGGGCATGCACAGGGCAGAGGG - Intronic
900656913 1:3763068-3763090 CAGGGGCTGGGCAGGGCTGCGGG - Intronic
900663743 1:3799763-3799785 AAGGGGGTGCAGGGGGGTGCAGG - Intergenic
900780123 1:4612467-4612489 CTGAGGATGCAAAGGGCTCCTGG + Intergenic
900821704 1:4894715-4894737 GCGGGTATGCAGAGTGCTGCTGG - Intergenic
901632308 1:10653803-10653825 CCAGGGACGCAGAGGACTGCTGG + Exonic
902631134 1:17705442-17705464 CGGTGGATGCAGTGGCCTGCAGG + Intergenic
902658243 1:17884199-17884221 CAGGGGCTGCAGAGGTAGGCAGG + Intergenic
902892129 1:19452142-19452164 CATGGGATGGAGAGGGATGGAGG - Intronic
903009480 1:20319802-20319824 CTGGGGATGCAGAGGCCTGGAGG - Intronic
903031747 1:20468578-20468600 CTGGGGATGCAGGGGGCTTTTGG - Intergenic
903221654 1:21872849-21872871 CAGGGGCTGCCCGGGGCTGCTGG - Intronic
903277809 1:22232930-22232952 GAGGGGGAGGAGAGGGCTGCAGG - Intergenic
903573250 1:24321878-24321900 CCGGGGCTGCCCAGGGCTGCGGG - Intronic
904267527 1:29326230-29326252 CAGGGGCTGCAGGGGGCAGTGGG - Intronic
904344604 1:29859711-29859733 CAGGAGATGCTGAGGGATGGAGG + Intergenic
905250723 1:36646519-36646541 CTGGGCATGCAGAGGGCCACAGG + Intergenic
905261742 1:36723870-36723892 CAGTTGATGCAAAGGGCTGAAGG + Intergenic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905918084 1:41699661-41699683 GAAAGGATGCAGAGGGATGCTGG + Intronic
905920130 1:41713855-41713877 GAGGGGCTGGAGAGAGCTGCAGG + Intronic
906563438 1:46778463-46778485 CCGGGGTTGCAGGGGGCTGGTGG + Intronic
906769328 1:48470774-48470796 AAGGAAATGCAGAGGGCTCCTGG + Intronic
907221427 1:52909826-52909848 CTGCAGATGCAGAGGGCTGACGG + Intronic
907388778 1:54142823-54142845 CAGGTGCTCCAGGGGGCTGCTGG - Intronic
908416904 1:63922032-63922054 CAGGAGATGCATAGAGCTTCTGG + Intronic
908627825 1:66066269-66066291 TAGGGGATGGAGGAGGCTGCGGG - Intronic
909601507 1:77466180-77466202 CAGCGGATGCAAAGGGCTGCAGG - Intronic
911841415 1:102686805-102686827 CATGGGATTCAGAGGGCTTCTGG + Intergenic
912471497 1:109910280-109910302 CAGAGGAAGAAGGGGGCTGCCGG + Intronic
912764615 1:112396845-112396867 CAGAGGATGCGAGGGGCTGCGGG - Intronic
913937131 1:125065466-125065488 CGAGGGAGGCAGAGGGCTGATGG - Intergenic
913989443 1:143596964-143596986 CAGGCGCAGCAGAGAGCTGCTGG - Intergenic
914054940 1:144161331-144161353 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
914124206 1:144805030-144805052 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
915354430 1:155247704-155247726 AAGAGGATGCTGGGGGCTGCTGG + Exonic
915444431 1:155966788-155966810 CAGGGAGGGCAGAGGGCTGGGGG - Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
915682728 1:157597149-157597171 CAGAGGATGCAGAGACCTGAAGG - Intronic
915899330 1:159835097-159835119 CTGAGGATTCAGAGGCCTGCAGG + Exonic
916427946 1:164699630-164699652 CAGGGGATGGAGAGGACGGAGGG + Intronic
918072068 1:181140410-181140432 CAGGAGAGGCAGATGTCTGCCGG + Intergenic
918257806 1:182765909-182765931 CAGATGATGCAATGGGCTGCAGG - Intergenic
919841275 1:201611084-201611106 CAGGGGAAGCTGAGGTCTACTGG - Intergenic
920245242 1:204582908-204582930 CAGGGGAAGTAGATGACTGCTGG + Intergenic
920298176 1:204972512-204972534 CAGAGGCTGGAGAGGGCTGGGGG - Intronic
920370297 1:205474631-205474653 CAGGGGTTGGAGAGGGATGGGGG - Intergenic
920496872 1:206461179-206461201 CTGGGTGTGCAGAGGGCTGGAGG - Exonic
920632815 1:207669319-207669341 CAGAGCATGGGGAGGGCTGCGGG - Intronic
920647063 1:207811612-207811634 AAGTGGAAGCAGAGGGCTGGAGG - Intergenic
920730708 1:208481360-208481382 CAAGGAATGCAGAGGGGTTCAGG - Intergenic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922720142 1:227896148-227896170 CAGGGGAGGCAGCTGGATGCTGG - Intergenic
923302057 1:232650521-232650543 GATTGGAGGCAGAGGGCTGCTGG + Intergenic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
924740176 1:246790248-246790270 CAGGGAGGGGAGAGGGCTGCTGG + Intergenic
924939827 1:248805357-248805379 CGGAGGGAGCAGAGGGCTGCTGG - Intergenic
1062964065 10:1593918-1593940 CATGGGATTCGGAGAGCTGCAGG + Intronic
1063247020 10:4231690-4231712 CAGGGGTGGCAGAAGGGTGCTGG + Intergenic
1063371511 10:5525607-5525629 CAGGGGAGGCAGGGGGATGGGGG - Exonic
1063588310 10:7372880-7372902 TAGGGCAGGCAGGGGGCTGCAGG - Intronic
1065115259 10:22477605-22477627 CTGGGGAGGGAGCGGGCTGCAGG - Intergenic
1067043274 10:42969920-42969942 CAGCAAATGCAGAGGGCTGGAGG - Intergenic
1067043427 10:42970554-42970576 TCGGGGCTGCAGAGGGCTGGAGG - Intergenic
1067370609 10:45678608-45678630 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067389172 10:45847548-45847570 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067416898 10:46109410-46109432 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067445085 10:46337001-46337023 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067502300 10:46816293-46816315 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067546015 10:47193172-47193194 CAGGGGAAACAGAGGGCAGGAGG + Intergenic
1067592287 10:47523727-47523749 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067639403 10:48031800-48031822 CAGGGGAGGCAGCAGGGTGCGGG - Intergenic
1067874091 10:49988505-49988527 CAGGGGAGGCAGCAGGGTGCGGG + Intronic
1068783301 10:60944215-60944237 CAGGCGAAGGGGAGGGCTGCGGG - Exonic
1069756569 10:70777378-70777400 GAGGGGAGGAAGAGGGCTGAGGG + Intronic
1070533970 10:77361665-77361687 GAGGGGATCCATAGGTCTGCTGG + Intronic
1070566550 10:77607655-77607677 CTGGGGATGCAGGTGGCTACTGG + Intronic
1070759132 10:79012579-79012601 CAGGAGATGCAAAAGGCGGCTGG - Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071499355 10:86192510-86192532 CAGTGGGTGCTGAGGGCTGAAGG + Intronic
1071933143 10:90496472-90496494 CAGGGGAAACAGAGAGCTGTGGG + Intergenic
1072903749 10:99431491-99431513 CAGCAGATGGAGAGGGCTCCTGG - Intergenic
1074116308 10:110459770-110459792 CAGGGAATGCACAGGGTTGCCGG + Intergenic
1074824090 10:117202150-117202172 CAGGGGTTGCAGAGAGAGGCTGG + Intronic
1075588643 10:123675898-123675920 CTGAGGATGCTGGGGGCTGCTGG - Intronic
1076031642 10:127164082-127164104 CAGGGGACGCAGGGGTCAGCCGG + Intronic
1076821424 10:132941891-132941913 CAGCGGATGCAGAGTGGGGCTGG - Intronic
1076878995 10:133230888-133230910 CGGGGGCTGCCGAGGGCTGCGGG + Intronic
1077120396 11:904844-904866 CTCGGGGTCCAGAGGGCTGCAGG + Intronic
1077155486 11:1089148-1089170 CTGGGGAGGCAGAGGGAGGCCGG - Intergenic
1077530300 11:3091860-3091882 CAGAGGGTGCAGAGCGCGGCCGG - Intronic
1077551613 11:3203037-3203059 CAGGGCAGGCAGCGGGCTCCAGG - Intergenic
1077551941 11:3204344-3204366 CAGGTGATCCCGAAGGCTGCAGG + Intergenic
1077821987 11:5754981-5755003 CAGAAGATGCAGAGGGCTTTAGG - Exonic
1078396859 11:10989064-10989086 CAGGACATGCAGAGGGCTTTGGG - Intergenic
1079109852 11:17599219-17599241 CCGGGGATGCTGGGGGCTCCCGG + Intronic
1079331892 11:19540556-19540578 CAGGGGATGGGGAGGGTTGGAGG - Intronic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1080039031 11:27739458-27739480 CAGGTGATGCACAGGGGTCCAGG + Intergenic
1080640520 11:34155785-34155807 CAGGGGCTGCAGAAGGCCGTGGG - Intronic
1081932447 11:46881494-46881516 CAGGGGTGGGAAAGGGCTGCTGG - Intronic
1082160426 11:48883242-48883264 CAGGAGGTGCACAGGGCTGGGGG + Intergenic
1082161940 11:48897164-48897186 CAGGAGGTGCACAGGGCTGGGGG - Intergenic
1082167525 11:48965608-48965630 CAGGAGGTGCACAGGGCTGGGGG - Intergenic
1082239492 11:49855598-49855620 CAGGAGGTGCACAGGGCTGGGGG + Intergenic
1082609536 11:55280970-55280992 CAGGAGGTGCACAGGGCTGGGGG + Intergenic
1082808236 11:57463334-57463356 CAGGGGATGGCTAGAGCTGCAGG - Intronic
1083628015 11:64081904-64081926 CCGGGAGTCCAGAGGGCTGCAGG - Intronic
1083815730 11:65131381-65131403 GAGGGGATGCAGAAAGCAGCAGG + Intronic
1083885202 11:65570121-65570143 CAGGGGAGGCGGAGGCCAGCGGG + Intergenic
1084016888 11:66388961-66388983 CAGGGGAAGCTGCTGGCTGCTGG + Intergenic
1084287430 11:68141243-68141265 CTGTGGCTGCAGGGGGCTGCAGG + Intergenic
1084289570 11:68153130-68153152 GAAGGGAGGCAGAGCGCTGCTGG - Intergenic
1084426521 11:69087134-69087156 AAGGGGCTGCAGGTGGCTGCGGG - Exonic
1084429262 11:69102211-69102233 CTGGGGATGCAGTGGGCCACTGG + Intergenic
1084489740 11:69471781-69471803 GAGGGGAAGCAGAGGGTTACAGG + Intergenic
1084517336 11:69644003-69644025 AAGGGGAGGCCGGGGGCTGCCGG - Intronic
1084538853 11:69774544-69774566 CAGGGGTTGCGCTGGGCTGCCGG + Intronic
1084603476 11:70159896-70159918 CAGGGTGTGGTGAGGGCTGCAGG + Intronic
1084740294 11:71135051-71135073 CAGAGAAGGCTGAGGGCTGCGGG - Intronic
1084948450 11:72651713-72651735 CAGAGGATGCTGAGGCCTGCTGG - Intronic
1085257181 11:75181765-75181787 CCCTGGATGGAGAGGGCTGCTGG - Intronic
1085385945 11:76158454-76158476 AAGGGGATGCAGATGAGTGCGGG + Intergenic
1088455950 11:110033275-110033297 CAGGAGGTGCAGAGGGTTCCAGG + Intergenic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1089325668 11:117655142-117655164 CAGGGCATGGAGATGGCAGCTGG - Intronic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089846725 11:121464615-121464637 CAGGGCACGCAGGGGGCTGAGGG + Intronic
1091187215 11:133657586-133657608 CTGGGTATTCAGAGGGCTTCGGG + Intergenic
1091194533 11:133719971-133719993 CAGGGGATGCTCCTGGCTGCAGG - Intergenic
1091318451 11:134632602-134632624 CATGGCAGGCCGAGGGCTGCTGG - Intergenic
1091439607 12:502289-502311 CACCTGATGCCGAGGGCTGCAGG - Intronic
1091600404 12:1914530-1914552 GAGTGGATGCAGTGGGATGCAGG - Intronic
1091793720 12:3285784-3285806 CAGGGTTTGTAGAGGACTGCAGG + Exonic
1094221696 12:28000936-28000958 CAGGGCAGCCTGAGGGCTGCTGG + Intergenic
1095125972 12:38477743-38477765 CAGGGCATACAGAGGGCATCAGG - Intergenic
1095978894 12:47959103-47959125 CAGGGCAGCCACAGGGCTGCTGG - Intergenic
1096567288 12:52492511-52492533 CAGAGAGTGCAGATGGCTGCTGG - Intronic
1096779711 12:53984889-53984911 CAGGGGAGGTAGAGGGGTGGAGG - Intergenic
1096975613 12:55697860-55697882 CAGGGGAGGCAGAGGCCTGCGGG - Intronic
1097710832 12:62915313-62915335 CGCGTGAGGCAGAGGGCTGCAGG - Intronic
1100882698 12:99036059-99036081 CAGGGAATGCAGAGAGGTGCAGG - Intronic
1101647549 12:106645225-106645247 CTGGGGATGGTGAGCGCTGCTGG + Intronic
1102162706 12:110782431-110782453 CAGGGAGTGCAGAGAGGTGCAGG + Intergenic
1102559146 12:113749694-113749716 CAGGTGATGAAGAAGGCTGGGGG - Intergenic
1102587127 12:113931350-113931372 GAGGCCATGCTGAGGGCTGCTGG - Intronic
1102871907 12:116420367-116420389 CAGGAGATGCAGGGGGCTCTGGG - Intergenic
1103147744 12:118610245-118610267 CAGGTGATGCAGAGTGAGGCAGG - Intergenic
1103601994 12:122060181-122060203 CGGGGGAGGCAAAGGGCAGCAGG - Exonic
1103737758 12:123071158-123071180 TAGGGTGGGCAGAGGGCTGCAGG + Intronic
1104004843 12:124884734-124884756 CAAGAAATGCCGAGGGCTGCTGG + Intergenic
1104329467 12:127830896-127830918 CAGTGAATGCAAAGGGCTGGAGG + Intergenic
1104439983 12:128786663-128786685 CAGGGGATCCCGGAGGCTGCTGG + Intergenic
1104585123 12:130042325-130042347 CTGGGGAAGCGCAGGGCTGCGGG + Intergenic
1104623524 12:130336111-130336133 CGGGGGCTGGAGAGGGCTGAAGG - Intergenic
1104725678 12:131074351-131074373 CAGGGGCTGCTGAGCTCTGCTGG - Intronic
1104951799 12:132444470-132444492 CAGGGGAGACAGAGGGCTCCGGG - Intergenic
1105377936 13:19862682-19862704 CTGGGGATGCAGTGGGCTCGGGG + Intronic
1106033740 13:26025524-26025546 CTGGTGATGCAGAGGGAAGCAGG + Exonic
1106102279 13:26705485-26705507 CAGGTCATGCAGGGGGATGCAGG + Intergenic
1106198130 13:27511327-27511349 CAGAGGTTGCAAAGGGCTGAGGG - Intergenic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1106328669 13:28718788-28718810 GCGGGGAAGCCGAGGGCTGCCGG - Exonic
1106978543 13:35251293-35251315 AAGCGGATGCACAGGGATGCTGG - Intronic
1107606583 13:42063574-42063596 CAGTGGCTGGAGAGGGATGCTGG + Intronic
1108229227 13:48319506-48319528 GAAGGGCTGCAGGGGGCTGCTGG + Intronic
1108715794 13:53076699-53076721 GAGGGGTTGAAGAAGGCTGCGGG + Intergenic
1111442917 13:88304301-88304323 CTGAGGATGCACAGGGCAGCAGG - Intergenic
1112331803 13:98482753-98482775 CAGGGGAGGCTCAGTGCTGCAGG - Intronic
1112629975 13:101149882-101149904 GAGAGGATCCACAGGGCTGCTGG - Intronic
1113047160 13:106168439-106168461 CCCGGTATGCTGAGGGCTGCAGG - Intergenic
1114033292 14:18595485-18595507 GAGGGAATGCAGAGAGCTGTGGG + Intergenic
1114078086 14:19174685-19174707 GAGGGAATGCAGAGAGCTGCGGG + Intergenic
1114125408 14:19719868-19719890 GAGGGAATGCAGAGAGCTGTGGG - Intronic
1114506102 14:23215181-23215203 CAGGAGAGGCAGAGGGGTGGGGG - Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1119482271 14:74965455-74965477 CAAGGGGTGCAGAGGGGAGCCGG + Intergenic
1119647621 14:76359720-76359742 CAGGGAAAGCAGAGGGCTTGTGG + Intronic
1121349462 14:93161891-93161913 CAAGGGATGCCGAGGATTGCTGG + Intergenic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121472063 14:94163784-94163806 CAGGGTATACTGAGGGCTTCTGG - Intronic
1121560828 14:94874033-94874055 GAGGGGCTGCAGAGGGGAGCAGG - Intergenic
1121972713 14:98373324-98373346 CAAGGGATGCCAAGGACTGCAGG - Intergenic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122354221 14:101113547-101113569 CGGGGGAGGCAGAGGTCTGAGGG + Intergenic
1122755247 14:103973543-103973565 GAGAAGAGGCAGAGGGCTGCCGG + Intronic
1123037797 14:105478515-105478537 CAGGGCAGGCCGAGGGCAGCCGG - Intronic
1202902249 14_GL000194v1_random:50617-50639 GAGGGGTTGCTGGGGGCTGCTGG - Intergenic
1123787062 15:23684677-23684699 CAGAGGATGGGGTGGGCTGCGGG - Intergenic
1124341735 15:28894347-28894369 GAGGGCATGGAGGGGGCTGCTGG + Intronic
1124379317 15:29151430-29151452 CAGGGGATGTCCAGGGCTGCAGG + Intronic
1125535705 15:40440524-40440546 AAGGGGATGCGGAGGGGTGATGG + Intronic
1125891008 15:43267211-43267233 AGAGGGATGCAGGGGGCTGCTGG + Intergenic
1125972807 15:43925796-43925818 GAGTGGCTGCAGAGAGCTGCAGG - Intronic
1127534648 15:59878836-59878858 CAGGAAATCCAAAGGGCTGCTGG - Intergenic
1128228870 15:66021133-66021155 GAGGTGATGCAGGGGCCTGCAGG + Intronic
1128317395 15:66669811-66669833 GGGGGGATGCAGAGGCTTGCAGG + Intronic
1128326793 15:66729233-66729255 CGGGGGATGCAGGGAGATGCAGG - Intronic
1128386669 15:67154047-67154069 CAGAGGTTGCAGAAGGCTCCTGG - Intronic
1128552995 15:68610169-68610191 CACTGGAACCAGAGGGCTGCAGG - Intronic
1128599920 15:68987628-68987650 CAGAGGATGCAGGGCGCTGCTGG - Intronic
1129195669 15:73964815-73964837 CAGGGGTTGCTGAGAGCTGAGGG - Intergenic
1129457795 15:75684945-75684967 CAGGGCATGAAGGGTGCTGCTGG - Intronic
1129587646 15:76884993-76885015 CAGAGGTTGCTGAAGGCTGCGGG + Intronic
1130047553 15:80457544-80457566 TAGGTGATGCAGAGGGGTGCAGG + Intronic
1130090539 15:80817166-80817188 CTGGGGATGCGGAAGGCTGTGGG + Intronic
1131476868 15:92747276-92747298 CAGGGAATGCCAAGGGCTGCTGG - Intronic
1131511317 15:93050974-93050996 CTGAGTATGCGGAGGGCTGCGGG + Intronic
1131519331 15:93101470-93101492 CAGGGGAAGTACAGGGCTGCTGG + Intergenic
1131927433 15:97401157-97401179 CTGGGGATGCTGAGGCCTGGAGG - Intergenic
1132224126 15:100127391-100127413 CAGGGGAGGCCAAGGGTTGCCGG + Intronic
1132380180 15:101360716-101360738 CAGGGGATGCTGAGGCCCCCGGG - Intronic
1132471354 16:105343-105365 CAGAGGATGCAGAGGTTTGCAGG - Intronic
1132908769 16:2297931-2297953 CAGGGGACGCAGGGAGATGCAGG + Intronic
1132920293 16:2386072-2386094 CAGGGGACGCAGGGAGATGCAGG - Intergenic
1133125462 16:3643132-3643154 CAGAGGAGCCAGAGAGCTGCAGG + Intronic
1133771114 16:8867726-8867748 CAGGGAGTGCAGAGGGCGGTGGG + Intronic
1133933308 16:10249718-10249740 CAGGACATGCAGGGGGCAGCTGG - Intergenic
1134071006 16:11259743-11259765 CAGGGGACTCAGAGGTCTTCAGG + Intronic
1134480525 16:14614981-14615003 CCGGGGATGGAGAAGGCTACAGG + Intronic
1135726571 16:24858657-24858679 CTGTGGAGGCTGAGGGCTGCTGG - Exonic
1135934527 16:26768405-26768427 CAGGGGATCCAGGGGTCTGGGGG - Intergenic
1136089229 16:27906555-27906577 CAGGAGGTGCAGAGGGCCCCGGG - Intronic
1136184711 16:28580476-28580498 CAGGGGATGCCAAGGACTGCCGG - Intronic
1136609447 16:31357230-31357252 CTGGGGACACAGCGGGCTGCTGG - Intronic
1136779247 16:32886425-32886447 AAGGGGAGGCGGAGGGCTGAGGG - Intergenic
1136891370 16:33975093-33975115 AAGGGGAGGCGGAGGGCTGAGGG + Intergenic
1136986596 16:35112254-35112276 CAGGGGATGCAGAAGCCTGCAGG + Intergenic
1137528536 16:49261012-49261034 CGGGGGAGGCAGAGGACTTCAGG - Intergenic
1137574603 16:49590612-49590634 AAGGGGAAGCACAGGGCTGGGGG - Intronic
1137998075 16:53241945-53241967 GAGGGGATGCAGCCGACTGCGGG - Intronic
1138338140 16:56268959-56268981 CTGGGGAGGCAGATGGCTTCAGG + Intronic
1139476045 16:67203044-67203066 GAGGGCAGGCAGAGGGCGGCTGG + Intronic
1139548872 16:67662553-67662575 CAGGGAGGGCAGAGAGCTGCGGG - Exonic
1140724202 16:77797497-77797519 GTGGGGATGCAGGGGGCTGGTGG - Intronic
1140889339 16:79271896-79271918 CAGGGGAGGCAGAGGGGTCAGGG - Intergenic
1141005521 16:80348197-80348219 CTGGGGCTGCAGACGGCTTCAGG + Intergenic
1141410282 16:83828436-83828458 CGGAGGATGAAAAGGGCTGCAGG - Intergenic
1141570747 16:84932203-84932225 CAGTGGCTGCAGGGAGCTGCGGG + Intergenic
1141635724 16:85312951-85312973 CAGGGGATGAAGCGGGCCTCAGG + Intergenic
1141648238 16:85378702-85378724 CAGGGCAGGCACAGGGCTGCAGG - Intergenic
1141877295 16:86834634-86834656 CAGATGGTGGAGAGGGCTGCAGG - Intergenic
1141955292 16:87366749-87366771 GAGGGGAGGCAGAGGGCAGACGG + Intronic
1142025476 16:87810614-87810636 CTGGGGCTGCAGTGGGGTGCAGG - Intergenic
1142282673 16:89156737-89156759 GAGGGAAGGCAGAGGGCGGCAGG - Intergenic
1142358781 16:89616468-89616490 CCGGGGATGCAGATGCCTCCTGG - Intronic
1142359231 16:89618988-89619010 CGGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359259 16:89619049-89619071 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359286 16:89619110-89619132 CAGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359396 16:89619352-89619374 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359411 16:89619383-89619405 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359495 16:89619573-89619595 CAGGGGGACCAGGGGGCTGCAGG - Intronic
1142359513 16:89619613-89619635 CAGAGGGAGCAGGGGGCTGCAGG - Intronic
1142359547 16:89619706-89619728 AAGGGAGTGCAGGGGGCTGCAGG - Intronic
1142359569 16:89619769-89619791 GAGGGGGTGCAGGGGGCTGCAGG - Intronic
1203081663 16_KI270728v1_random:1148513-1148535 AAGGGGAGGCGGAGGGCTGAGGG - Intergenic
1143115803 17:4581398-4581420 CCTGGGGTGCAGAGGGCTGGAGG + Intergenic
1143302577 17:5921954-5921976 CATTTGAGGCAGAGGGCTGCTGG + Intronic
1143307062 17:5955802-5955824 CAGGGCATGCAAAGACCTGCAGG + Intronic
1144186817 17:12804306-12804328 GAGGGGTTGCAGAGGGCTGATGG + Intronic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145776431 17:27532254-27532276 CAGGAGATGCAGAGCCCTGTGGG + Intronic
1145796998 17:27661266-27661288 CGGGGGGCTCAGAGGGCTGCTGG - Intergenic
1145798388 17:27668664-27668686 CTGGGGATGCAGGGCACTGCAGG + Intergenic
1146000693 17:29128583-29128605 CATGGGATGGGCAGGGCTGCAGG - Intronic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146842107 17:36163455-36163477 CGGGGGGCTCAGAGGGCTGCTGG + Intergenic
1146845568 17:36179604-36179626 TAGCGCAAGCAGAGGGCTGCAGG - Intronic
1146854415 17:36251414-36251436 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1146870318 17:36375306-36375328 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1146873785 17:36391445-36391467 TAGCGCAAGCAGAGGGCTGCAGG - Intronic
1146877675 17:36426387-36426409 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1146881142 17:36442535-36442557 TAGCGCAAGCAGAGGGCTGCAGG - Intergenic
1146885636 17:36469056-36469078 CACGGGATGTTGAGAGCTGCCGG - Intergenic
1146905184 17:36613520-36613542 AAGGGGAGGCAGAGGGGTTCTGG - Intergenic
1147065605 17:37921426-37921448 TAGCGCAAGCAGAGGGCTGCAGG + Intergenic
1147073199 17:37975930-37975952 CGGGGGGCTCAGAGGGCTGCTGG + Intergenic
1147084721 17:38055468-38055490 CGGGGGGCTCAGAGGGCTGCTGG + Intronic
1147100668 17:38179434-38179456 CGGGGGGCTCAGAGGGCTGCTGG + Intergenic
1147259063 17:39197934-39197956 CAGTGGATGCCGAGCGCTGATGG + Intergenic
1147324635 17:39664417-39664439 CAGGGGAGACAGATGGCTGTGGG - Exonic
1147952762 17:44116155-44116177 CAGGGACTGCAGATGGCTCCTGG + Intronic
1148439827 17:47706224-47706246 CAGGGGAAGGAGAGGGCTCTGGG - Intronic
1148551011 17:48550823-48550845 CATGGGCTGCGGGGGGCTGCCGG + Exonic
1149555509 17:57570801-57570823 CATGGTATGCAGAAGGCTGCTGG + Intronic
1149564264 17:57630186-57630208 CGGGGGATGGACTGGGCTGCAGG + Intronic
1150083605 17:62262481-62262503 CAGGGGGCTCAGAGGGCTGCTGG + Intergenic
1150130060 17:62664333-62664355 CAGATGAGGCAGAGGCCTGCAGG - Intronic
1150641628 17:66953446-66953468 CAGGGGAGGGACAGGCCTGCTGG - Intergenic
1151106762 17:71624320-71624342 CAAGGAATGCAGGGGGCTTCTGG + Intergenic
1151348449 17:73517494-73517516 CAGGGAATGCCAAGGACTGCTGG + Intronic
1151357236 17:73567147-73567169 CTGGGGCCGCAGAGGGCAGCAGG - Intronic
1151398232 17:73839074-73839096 CAGGGGATGCAGAGCCAAGCTGG - Intergenic
1151491430 17:74434002-74434024 CAGGGGGCGCAGAGGCCTGGTGG - Intronic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151767806 17:76141090-76141112 TAAGGGATGGGGAGGGCTGCAGG - Intronic
1151896909 17:76986734-76986756 CAGGGGACAAAGAGGGCTGGGGG + Intergenic
1152056446 17:78031631-78031653 AACGGGATGCAGCTGGCTGCTGG - Exonic
1152066391 17:78114936-78114958 CGGGGAATGCAGAGTGGTGCTGG - Intronic
1152223505 17:79082089-79082111 CAGGGGAGGCACTGGGCCGCTGG - Intronic
1152369710 17:79878693-79878715 GAGGGCAGGCAGAGGGCTGTGGG - Intergenic
1152446855 17:80349925-80349947 CTGGGGAGGGAGAGGGCAGCAGG - Intronic
1152522132 17:80862743-80862765 CAGGGACGGCTGAGGGCTGCAGG - Intronic
1152684644 17:81688053-81688075 CTGAGGATGCAGAGGGGTTCTGG + Intronic
1152723011 17:81932022-81932044 CAGGGTATGCAGGGGGCTCCAGG - Intergenic
1152903501 17:82958219-82958241 CAGGGGATGCAGAGGCCAACGGG + Intronic
1152930526 17:83107450-83107472 CAGGGGACTGTGAGGGCTGCGGG + Intergenic
1153238584 18:3011865-3011887 CAGGGGATGGAGACAGGTGCTGG - Exonic
1153481242 18:5548953-5548975 CAGGGGATGGACAGGCTTGCTGG - Intronic
1153505299 18:5790595-5790617 CAAGGAATGGAGAGGGCTGCTGG + Intergenic
1153625120 18:7016034-7016056 CAGGAGATGCTGAGGGAAGCGGG + Intronic
1153813519 18:8773234-8773256 CAGGGGGTGCAGGGGGATGGTGG - Intronic
1154269121 18:12904233-12904255 CAGAGGAGCCTGAGGGCTGCTGG - Intronic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155100727 18:22607622-22607644 CAGGGGAGGCAGAGATCAGCAGG - Intergenic
1155352187 18:24917640-24917662 CAGGGGAGGAAGAGGGCGGGGGG + Intergenic
1156363761 18:36407074-36407096 CAGGGAAAGCAGAGGACAGCAGG - Intronic
1157045655 18:44099463-44099485 CAGGGGAGGTAGAGGCTTGCAGG + Intergenic
1157221349 18:45830292-45830314 CAGGGTAGGCAGAGAGCTCCAGG - Intronic
1157241597 18:46015032-46015054 CAAGGGAGTCAGAGGGATGCAGG + Intronic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1158266720 18:55667045-55667067 CAGGGCATGCTGCAGGCTGCAGG + Intergenic
1158440578 18:57471130-57471152 GAGGGGATGCAAAGGGAGGCGGG - Intronic
1158490726 18:57907311-57907333 GAGGGGATGCTGAGGCCTGAAGG - Intergenic
1158884666 18:61815839-61815861 CTGTGGCTGAAGAGGGCTGCAGG - Exonic
1158973328 18:62688364-62688386 CAGGGAATGCCAAGGGCTGCAGG - Intergenic
1160078830 18:75703886-75703908 CTGGGGGTGCAGAGAGCTGTGGG + Intergenic
1160078883 18:75704110-75704132 CTGGGGATGCAGAGACCTGGGGG + Intergenic
1160119843 18:76120549-76120571 CAGGGGATGCTGCTGGCAGCTGG - Intergenic
1160222954 18:76990471-76990493 CAGGGGATGGTGAGGGATGAGGG + Intronic
1160239775 18:77114853-77114875 CAGGGCGAGCAGTGGGCTGCAGG + Intronic
1160479053 18:79221334-79221356 CTGTGGAAGCAGATGGCTGCAGG - Intronic
1160528047 18:79548703-79548725 CTGCGGATGCTGATGGCTGCCGG - Intergenic
1160550943 18:79693664-79693686 TCGGGGATGGAGTGGGCTGCCGG - Intronic
1161192782 19:2968401-2968423 CAGGGGATGGAGGGGGCTTTTGG - Intergenic
1161644369 19:5444134-5444156 GAGGGGATCCTGATGGCTGCAGG - Intergenic
1162899972 19:13789128-13789150 CAGATGCTGAAGAGGGCTGCTGG + Intergenic
1163721339 19:18899585-18899607 GAGGGGATGCAGGTGGATGCCGG + Exonic
1164702173 19:30293420-30293442 TAGGGGATGTTGGGGGCTGCAGG + Intronic
1164922295 19:32097537-32097559 TCTGGGATGCAGAGGGCTGGGGG - Intergenic
1164998285 19:32739669-32739691 CAGGAGATGCAGAGAGCAGCAGG - Intronic
1165333812 19:35155458-35155480 CAGGGCAGGGAAAGGGCTGCAGG + Exonic
1166079440 19:40434373-40434395 CAGGGCAGGCAGAGAGCTGCAGG + Intergenic
1166211046 19:41306690-41306712 GAGGGGAGGCAGTGGGCTGGAGG - Exonic
1166231565 19:41427963-41427985 CAGGCGATGGAGAGAGCTGAGGG + Intronic
1166343111 19:42150414-42150436 GAGGGGGTGGAGAGGGCTGGGGG + Intronic
1167252789 19:48409706-48409728 TAGCGGATGGAGAGGGTTGCAGG + Intronic
1167591351 19:50406145-50406167 CAGGGTGTGCAGCAGGCTGCGGG - Intronic
1168287575 19:55342208-55342230 CAGGGGGGGCACAGGGCTGGGGG - Exonic
1168405384 19:56107815-56107837 CCGGGCATGCTGGGGGCTGCGGG + Intronic
1168405405 19:56107893-56107915 CCGGGCATGCTGGGGGCTGCGGG + Intronic
1168720067 19:58549989-58550011 CAGCTGATGCAGGGGGCGGCAGG - Exonic
1202694422 1_KI270712v1_random:114006-114028 CAGGCCATGGAGAGGGCAGCTGG + Intergenic
925189243 2:1869394-1869416 CAGGGAATGCAGCTGGCTACTGG - Intronic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926167800 2:10532384-10532406 CAAGGAATGCTGAGGACTGCTGG + Intergenic
926768987 2:16351349-16351371 CAGAGGCTGCACAGGGCAGCAGG - Intergenic
927666559 2:25036831-25036853 TAGGGATTGGAGAGGGCTGCAGG - Intergenic
928629654 2:33177961-33177983 CAGGGGGTACAGAGGGGTGCAGG - Intronic
929600882 2:43203931-43203953 CTGGGGATGCCCAGGGCTGCAGG - Intergenic
929935812 2:46294059-46294081 CCTGGGATGCAGTGGGCTGGTGG - Intronic
929978735 2:46659040-46659062 GAGGGCATGGAAAGGGCTGCAGG - Intergenic
930551113 2:52836018-52836040 CAGGGAATGCCAAGGGTTGCAGG - Intergenic
931289706 2:60861810-60861832 CAGGGGATGCAGATGCATCCAGG - Intergenic
931863343 2:66380772-66380794 CACGGGATGGAAAGGGATGCTGG - Intergenic
932436506 2:71705165-71705187 TAGGGTATGCAGAGGTCTTCGGG + Intergenic
932494649 2:72140348-72140370 CAGGGGCTGCTGAGGGGGGCGGG - Intronic
933848627 2:86347997-86348019 CAAGGAATGCGAAGGGCTGCCGG - Intergenic
933952139 2:87340558-87340580 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
934236383 2:90236896-90236918 CAGGCCATGGAGAGGGCAGCTGG - Intergenic
934504436 2:94879814-94879836 GAGGGGTTGCTGGGGGCTGCTGG + Intergenic
934562484 2:95320481-95320503 CAGGGGCTGCTGAGGGGTGGCGG - Intronic
934572891 2:95383497-95383519 GGGGGGATGCTGTGGGCTGCAGG - Intronic
935189695 2:100766922-100766944 CAGGGGAAGCAGAGACCTTCTGG - Intergenic
935649445 2:105369868-105369890 CAGGGAATGCACAGGGCACCTGG + Intronic
936351079 2:111713088-111713110 CAGAGCATGCAGAGCCCTGCAGG + Intergenic
936907717 2:117556363-117556385 GAGGGGATGCAGATGGGGGCAGG - Intergenic
937338512 2:121076417-121076439 CAGGGGATGCAGGGAGCTCATGG - Intergenic
937477771 2:122230189-122230211 CAGTGGAGGCAGAGGCCTGCAGG - Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
938884005 2:135624535-135624557 CAGTGAGTGCAGAGTGCTGCTGG + Intronic
939057091 2:137379046-137379068 CTGGGAACGCAGAGGGCTACAGG + Intronic
940224839 2:151390364-151390386 CAGGGGAAGCTGCTGGCTGCTGG + Intergenic
940750818 2:157625596-157625618 GAGGGGGTGCAGAGGGGTGCAGG + Intronic
940963687 2:159814161-159814183 CGGGGACTGCAGAGGCCTGCAGG - Intronic
941094570 2:161222082-161222104 ATGGGGATGAAGAGGGCTGAAGG - Intronic
941490112 2:166133209-166133231 CAGGGAAGGCAGAGGGCAACTGG - Intergenic
943882405 2:193163309-193163331 CAAAGTATGCAGAGGGCTTCAGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946188111 2:217992666-217992688 CAGGGGAGAGAGAGGGGTGCGGG + Intronic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
946448173 2:219757562-219757584 CAGGAGTAGCAGAGGGCTGTGGG - Intergenic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
947989799 2:234477687-234477709 CAAGGAATGCTGAGGGCTGCCGG + Intergenic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948462839 2:238138667-238138689 CAGGGGACACGGAGGCCTGCAGG - Intergenic
948525890 2:238570564-238570586 CAAGGGATGCAGGGGGCTGCGGG + Intergenic
948842107 2:240656742-240656764 CAGAGACTGCAGATGGCTGCAGG + Intergenic
948868836 2:240788305-240788327 CAGGGGATGCCCAGGGCCTCAGG + Intronic
948902691 2:240964384-240964406 TAGGGGAGGCAGAGACCTGCTGG + Intronic
1168860784 20:1044637-1044659 CAGGGGATGCAGCATGGTGCAGG - Intergenic
1169861487 20:10157688-10157710 GAAGGGATGCATAGGACTGCTGG - Intergenic
1170129527 20:13003682-13003704 CAGGGCCTGAAGAGGGCTTCTGG + Intergenic
1170627991 20:18044121-18044143 CAGGGGAGGCATAGGTATGCTGG - Intronic
1170944390 20:20877921-20877943 CAGGGGATGCTGGGAGATGCAGG - Intergenic
1171531472 20:25856255-25856277 GAAGGGAGGCAGAGGGCTGATGG - Intronic
1171532890 20:25863754-25863776 GAAGGGAGGCAGAGGGCTGATGG - Intronic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1172106728 20:32521618-32521640 ACAGGGATGCAGAGGGCTGGGGG + Intronic
1172149615 20:32780633-32780655 AAGGGGAGGCCAAGGGCTGCGGG - Intronic
1172288537 20:33758431-33758453 AAGGGGATACAGAGTGCTGTGGG + Intronic
1173340266 20:42147010-42147032 CTGGGGATGCAGTGGGGTGAGGG - Intronic
1173929423 20:46806452-46806474 CAGGGGTTGCATGGGGTTGCAGG - Intergenic
1174105097 20:48156290-48156312 TAGGGGGTGCAGAGAGCTCCAGG + Intergenic
1174111598 20:48201419-48201441 CAGAGGATGGACAGGGCTCCAGG + Intergenic
1174143639 20:48434954-48434976 CATGAGATGCAGAGGGGAGCAGG - Intergenic
1174169542 20:48607414-48607436 CAGAGGATGGACAGGGCTCCAGG - Intergenic
1174177995 20:48657060-48657082 CAGGAGGCGCAGAGGGCGGCGGG + Exonic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1175373094 20:58505931-58505953 CAGGGAATGCCAAGGACTGCTGG + Intronic
1175424445 20:58854798-58854820 CAGGGGCTGCAGAGGCCGCCCGG - Exonic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175547172 20:59785891-59785913 CAGGGGATGCAGAGGGCCGTTGG - Intronic
1175547180 20:59785925-59785947 CAGGGGAGGCAGAGGGCCGTTGG - Intronic
1175624793 20:60481379-60481401 CAGGGAATGCAGAGGGACCCTGG - Intergenic
1175964964 20:62655823-62655845 CAAAGGGTGCAGAGAGCTGCCGG + Intronic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176621617 21:9065384-9065406 GAGGGGTTGCTGGGGGCTGCTGG - Intergenic
1178095802 21:29213553-29213575 CAAGGAATGCAGAGGGTTGCAGG - Intronic
1178431536 21:32522387-32522409 CCTGGGGTGCAGATGGCTGCAGG - Intergenic
1179495912 21:41771219-41771241 CAGGGGCTGGAGATGGCTGAGGG - Intergenic
1179585980 21:42374307-42374329 GAGGGGGTGCTCAGGGCTGCAGG + Intronic
1179821758 21:43941083-43941105 CAGGTGGTGCAGGGGGCAGCTGG + Intronic
1179908765 21:44437261-44437283 CAGGGGCTGCAGGGGGCTGCAGG - Intronic
1179954897 21:44733116-44733138 CAGAGGATGCAGAGAGCTACCGG - Intergenic
1179961178 21:44767677-44767699 CCTGGGATGGGGAGGGCTGCTGG - Intergenic
1179984824 21:44914368-44914390 CAGGGGAAGCAGGGGGCTGAGGG + Intronic
1180052480 21:45337706-45337728 CAGGGGACACTGGGGGCTGCTGG + Intergenic
1180457406 22:15522540-15522562 GAGGGAATGCAGAGAGCTGTGGG + Intergenic
1181041772 22:20195658-20195680 CAGTGAATGCTGAGGGCTCCTGG - Intergenic
1181293806 22:21818929-21818951 GAGGGGAGGCTGAAGGCTGCAGG + Intronic
1181496081 22:23288340-23288362 CAGGGGAACAAGAGGGCTGGGGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182693545 22:32180428-32180450 CAGGGGATGCAGCAGGGTTCAGG - Intergenic
1183482858 22:38074649-38074671 CAGGGAACGCAGGAGGCTGCAGG - Intronic
1183694553 22:39414281-39414303 CAGGGGATGGACAGGGCTGTAGG + Intronic
1183976719 22:41516522-41516544 CAGGGGAACCAGAGTTCTGCAGG - Intronic
1184348589 22:43928187-43928209 CAGAGGATGCAACTGGCTGCAGG - Intronic
1184791672 22:46703916-46703938 CAGCTGGTGCAGAGGGCAGCAGG - Intronic
1184798724 22:46747479-46747501 TAGGGGATGCAGAGTCCAGCAGG - Intergenic
1185072934 22:48667151-48667173 CAGGGGCAGCACAGGGCAGCAGG + Intronic
1185247611 22:49781403-49781425 CTGGGGAGGCGGAGGCCTGCAGG + Intronic
1185310191 22:50150073-50150095 CAGAGGATGCACAGAGCTGGAGG - Intronic
950007543 3:9701184-9701206 GAGTGGAAGCAGAGAGCTGCTGG + Intronic
950460760 3:13121008-13121030 AAGGGGTTGCAGGGTGCTGCTGG - Intergenic
950547395 3:13646515-13646537 CAGGGCATGCAGAGGGCATGTGG + Intergenic
950552376 3:13674604-13674626 CAGAGGATGCAGAGTGCTGTGGG + Intergenic
950722187 3:14891310-14891332 CAGCAGGTGCAGAGGGCGGCTGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952157865 3:30663013-30663035 CAGGGGATGCTGATGACTGCTGG + Intronic
953172993 3:40524753-40524775 GAGGCGATGCCGACGGCTGCCGG + Intergenic
953278324 3:41526532-41526554 CAGGGGAAGTTGAGTGCTGCAGG - Intronic
953853743 3:46485145-46485167 CAGGTGATGATAAGGGCTGCTGG + Intronic
954316421 3:49804036-49804058 CAGGGCAGGCATAGGGGTGCTGG - Intronic
955092863 3:55769489-55769511 CAGAGGATGCAAAGGTTTGCAGG + Intronic
956326834 3:68062237-68062259 CAGGGGATGGTGAGGACTGCAGG + Intronic
956849046 3:73211475-73211497 AAGGGGACGCAGAGGTCTCCTGG + Intergenic
956886392 3:73564440-73564462 CAGGTGCTGGAGAGGGCTGATGG - Intronic
957476719 3:80734838-80734860 CAGTGCAGCCAGAGGGCTGCTGG - Intergenic
959085609 3:101849021-101849043 CGGGGCAGGCAGAGGGGTGCGGG + Intronic
960634263 3:119768204-119768226 CAGGGGAGGCAGACAGCTCCTGG - Intergenic
961454194 3:127016174-127016196 CTGGGGAGGCAGAGGCCTGGTGG + Intronic
961718966 3:128879539-128879561 CAGGGGATGGAGAGGCCAGAAGG - Intronic
961816008 3:129550742-129550764 CAGGAGATGCTGAGGCCTACAGG + Exonic
962015959 3:131441265-131441287 AAAGGGTTGCTGAGGGCTGCAGG - Intergenic
962190403 3:133304512-133304534 CAGTGGTTGCATAGGGCTGGAGG - Intronic
963131832 3:141865312-141865334 CGTGGGATGCAGTGGGGTGCAGG + Intergenic
963511916 3:146257133-146257155 CAGAGGTTGCACAGGGCAGCAGG + Intergenic
965635780 3:170778994-170779016 CCATGGATGCAGAGGGCTGATGG + Intronic
966643136 3:182212684-182212706 CAGGGGATGCACTTGGCTGCTGG + Intergenic
967942509 3:194777052-194777074 CACTGGAGGGAGAGGGCTGCGGG + Intergenic
968584703 4:1410757-1410779 CAGGGGAGGAAGAGGGCGGCAGG + Intergenic
968758296 4:2427947-2427969 CAGGGGCTGGAGAGGGGAGCAGG + Intronic
968826955 4:2905650-2905672 CAGTCCATGCAGAGGGCAGCTGG - Intronic
968912124 4:3481595-3481617 TGGGGGATGGAGAGGGCTGAGGG + Intronic
969867932 4:10087383-10087405 CAGGGAAGGCAGAGCCCTGCAGG + Intronic
969872161 4:10111398-10111420 CAGGGGAAGCAGAGGGTGGTGGG - Intronic
970448044 4:16140258-16140280 CAGGGGTTTCAGAGGGAGGCTGG + Intergenic
971164832 4:24172294-24172316 CAGGGGATGGAGTGGGGTGGAGG - Intergenic
972405824 4:38745798-38745820 AAGGGCATGTAGAGGTCTGCTGG + Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
977221608 4:94344424-94344446 CAGGAGCTGCAGAGAGCTCCTGG - Intergenic
977922385 4:102659906-102659928 CTGGGGATGGAGAGGGTAGCTGG - Intronic
978777045 4:112515251-112515273 CTGCGGGTGCGGAGGGCTGCCGG - Exonic
979899454 4:126200008-126200030 CAGGGCATGCAGAGCTCTGTAGG - Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
983054644 4:163087237-163087259 CAGGAGAGGCCGAGCGCTGCAGG + Intergenic
983959455 4:173734629-173734651 CATGGCATGCACAGTGCTGCTGG + Intergenic
984041752 4:174743968-174743990 CAGGCAAGCCAGAGGGCTGCCGG + Intronic
984856363 4:184199321-184199343 CAGGGGTTGAAGTGGGCTGGGGG + Intronic
984901928 4:184593101-184593123 CAGGTGCTGCAGAGAGCTGGGGG - Intergenic
985218288 4:187675895-187675917 AATGGGATGCAGAGTGCTGCTGG + Intergenic
985610963 5:888270-888292 CAGGGAATACAGAGGGCTTTCGG + Intronic
985720207 5:1484933-1484955 CAGGGGAGGCGGAGGACGGCAGG + Intronic
985794574 5:1952692-1952714 CAGGGGAGGCTCTGGGCTGCCGG - Intergenic
986094862 5:4544531-4544553 CAAGGGAGGCAGAGTGCTCCGGG - Intergenic
991289713 5:65021591-65021613 CAGAGGATACAGAGTGCTGAGGG - Intergenic
993090512 5:83420644-83420666 CAGAGGAAGCAGAGGGCTGTGGG + Intergenic
994206783 5:97044376-97044398 CAGGGAAGGCAGAGGAGTGCTGG + Intergenic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
996749352 5:126873485-126873507 CAGGTGATGCAGCCTGCTGCTGG - Intronic
997411764 5:133696246-133696268 CAGGGCATGCAGGGGACTGGGGG + Intergenic
998203221 5:140141804-140141826 CATGGGATCCAGGTGGCTGCAGG + Intergenic
999195587 5:149779521-149779543 CCAGGGATGCAGTGGCCTGCTGG - Intronic
999754414 5:154653690-154653712 CTGGGCATGCACAGGTCTGCAGG - Intergenic
999806607 5:155087162-155087184 AGGGGAATCCAGAGGGCTGCTGG + Intergenic
1000114776 5:158143441-158143463 CAGGGCATGCAGTGGGGTGGGGG - Intergenic
1001154767 5:169263428-169263450 CAAGGAATGCCAAGGGCTGCTGG + Intronic
1001286140 5:170425453-170425475 GGGGGGAGGCAGAGAGCTGCTGG + Intronic
1001342916 5:170863272-170863294 CAGGGGAGGCAGTGGGTGGCAGG + Intronic
1002214951 5:177624544-177624566 CAGGGGAGGGAGAGGGATGTTGG + Intergenic
1002580876 5:180208950-180208972 CGGGGGCTGGGGAGGGCTGCCGG - Intronic
1002607379 5:180391206-180391228 CAGAGGATGCAGATGGCCACTGG - Intergenic
1002635041 5:180603125-180603147 CAGGGCGGGCAGAGGGCTGGAGG - Exonic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1003163026 6:3652090-3652112 CAGGGGAGGGAGAATGCTGCTGG - Intergenic
1003548938 6:7084959-7084981 GATGGGAAGAAGAGGGCTGCTGG - Intergenic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1006175003 6:32116376-32116398 CAGGGCATCCAGAGAGCTGCTGG - Intronic
1006430936 6:33995276-33995298 AAGGCGCTGCAGAGGGCTACAGG + Intergenic
1006445700 6:34078657-34078679 TAGGGGCTGCGGAGGGGTGCGGG - Intronic
1006794031 6:36721064-36721086 CAAGGGATGGTGAGGGCTGCAGG + Intronic
1007102678 6:39260935-39260957 CAGGGAATGGAGGGGGCTTCAGG - Intergenic
1007257800 6:40540916-40540938 CAGAGGCTGCAGGAGGCTGCTGG + Intronic
1007608349 6:43132295-43132317 GAGGATATGCAGAGGGCTGCAGG + Intronic
1007687469 6:43675453-43675475 CAAGAGGGGCAGAGGGCTGCAGG - Intronic
1007825128 6:44594610-44594632 AAGGGTCTGCAGAGGGCCGCAGG + Intergenic
1010439933 6:75882081-75882103 TAGGGGATGGTGAGGGGTGCGGG - Intronic
1010465476 6:76163018-76163040 CAGAGAATGTAGGGGGCTGCTGG + Intergenic
1011126178 6:84010271-84010293 CAGGGGATGCCAAGGGTTGCTGG + Intergenic
1012925338 6:105261832-105261854 CAGGGGATCCAGAGTGGGGCAGG - Intergenic
1013225763 6:108118532-108118554 CAGGGGGCGCAGGGGGCGGCCGG + Intronic
1013810875 6:114043012-114043034 CATGGGATCCACAGGTCTGCAGG - Intergenic
1015853451 6:137598833-137598855 CAGGGCATGCAGAATGCTGATGG - Intergenic
1016040943 6:139431537-139431559 GAGGGGATCCAGAGGGATGGGGG - Intergenic
1016409399 6:143765960-143765982 CTGGGAATGCCTAGGGCTGCTGG + Intronic
1016426570 6:143941942-143941964 CAGGGGATACCGAGGGGTGGAGG + Exonic
1017763185 6:157586670-157586692 CAGGGGTTGCCGAGGGCCGCTGG - Intronic
1017775025 6:157673765-157673787 CCGGGGCTGCAGAGGGCGGCTGG + Exonic
1018757374 6:166862274-166862296 CAAGGGACGCAGAGGCCGGCGGG + Exonic
1018842130 6:167524986-167525008 CAGGGGAAGGAGGGGGCAGCAGG - Intergenic
1020971882 7:14953903-14953925 CAGGTGATGCTGAAAGCTGCAGG - Intronic
1022187011 7:27979707-27979729 CAGGGGATTCGGGGAGCTGCAGG - Intronic
1022324886 7:29322222-29322244 CAGGGAAGGCAGAGACCTGCTGG - Intronic
1022962209 7:35438181-35438203 TGGAGGGTGCAGAGGGCTGCTGG + Intergenic
1023058584 7:36309242-36309264 CAGGGGAGGAAGGGGCCTGCAGG - Intergenic
1024000515 7:45186386-45186408 TCGGGCATGCAGAAGGCTGCCGG + Intergenic
1024220264 7:47281539-47281561 GAGGGGCTGCAGGTGGCTGCAGG - Intronic
1024264239 7:47594641-47594663 CTGGGGAGGCAGAGAGCTGCAGG - Intergenic
1024972429 7:55082904-55082926 CAAGGAATGCCAAGGGCTGCTGG - Intronic
1025236950 7:57240906-57240928 CAGGTGGTGCAGAGGACAGCTGG - Intergenic
1025284611 7:57651639-57651661 CGAGGGAGGCAGAGGGCTGATGG - Intergenic
1025713083 7:63929889-63929911 CAGGGGATGCAGAAGCCTGCAGG + Intergenic
1025996055 7:66528215-66528237 CTGGGGTTGCAGAGGGATGGGGG + Intergenic
1026875434 7:73876695-73876717 GAGGGGATGGGAAGGGCTGCTGG + Intergenic
1029404901 7:100368860-100368882 AAAGGGATGCAGAGGGCTTCTGG - Intronic
1031165699 7:118224721-118224743 CAGGTACTGGAGAGGGCTGCCGG + Exonic
1032192155 7:129771498-129771520 CAGGGGAGGCATGGGGATGCAGG - Intergenic
1032596753 7:133248710-133248732 CAGTGGTTGCCAAGGGCTGCAGG - Intergenic
1032668946 7:134065973-134065995 AAGGGGATTCAGTGGGCAGCTGG + Intronic
1032794993 7:135269868-135269890 GAGGGGATGGAGAGGCCAGCAGG + Intergenic
1033832346 7:145269736-145269758 GGGGGGATGCGGAGGGATGCGGG + Intergenic
1034393275 7:150801691-150801713 CAGGGGCAGCAGCCGGCTGCTGG + Exonic
1034498352 7:151435113-151435135 GAGGGGATGCAGGGGGCAGAGGG - Intronic
1035200324 7:157259702-157259724 CAGGGGCTGCACAGGGCTGGAGG + Intronic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1036656739 8:10681813-10681835 CAGTGGAGGCACAGGGCAGCCGG + Intronic
1037662733 8:20941337-20941359 CAGCAGATGCAGAGGGCAGGAGG + Intergenic
1038053687 8:23837677-23837699 GAGGGGAAGCAGAGGGGAGCAGG + Intergenic
1039517163 8:38143815-38143837 CGGGAGGAGCAGAGGGCTGCAGG + Exonic
1039561028 8:38512642-38512664 GAGGGGATGGAGAGGGAGGCAGG + Intronic
1039608414 8:38901164-38901186 CCGGGGAGGGAGAGGGGTGCCGG - Intergenic
1039904835 8:41779003-41779025 GTGGGGATGGAGAGGGCTGTGGG + Intronic
1040941043 8:52833995-52834017 CAGGGAAGACTGAGGGCTGCAGG - Intergenic
1041491471 8:58438024-58438046 CAGAGGCTGCACAGGGCAGCTGG - Intronic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1042090279 8:65152083-65152105 CCGGGGATGCAGTGGGCTGAGGG - Intergenic
1043970896 8:86527320-86527342 CAGGGAATGAAAGGGGCTGCAGG - Intronic
1044866248 8:96574014-96574036 GAGGGGGTGCAGAGGGCAGGGGG - Intronic
1045590823 8:103594654-103594676 AAGGGAATGCAGATTGCTGCTGG + Intronic
1045636705 8:104199648-104199670 CAGGGGATTCAGAGAGCTGGTGG + Intronic
1045650311 8:104336194-104336216 CAAGGAAGGGAGAGGGCTGCAGG + Intronic
1045684246 8:104694830-104694852 CAGGGTATGCAAAGGTCTGGAGG + Intronic
1045754611 8:105528103-105528125 AAATGGATGCAGAGGGCTGCAGG + Intronic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1048881673 8:138877091-138877113 GAGGGGAGGCAGAGGGCTGATGG - Intronic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049430006 8:142557767-142557789 GAGGGGATGCTGGGGGCTGGTGG - Intergenic
1049437783 8:142595654-142595676 TTGGGGATGCACAGGGCTGAGGG - Intergenic
1049582123 8:143417567-143417589 CAGGGGCTGGACAGGGGTGCTGG + Intergenic
1049582132 8:143417591-143417613 CAGGGGCTGGACAGGGGTGCTGG + Intergenic
1049582141 8:143417615-143417637 CAGGGGCTGGACAGGGGTGCTGG + Intergenic
1049582150 8:143417639-143417661 CAGGGGCTGGACAGGGGTGCTGG + Intergenic
1049604980 8:143525193-143525215 CAGGGCAGGCCGAGCGCTGCTGG - Intronic
1050204376 9:3181616-3181638 GAGGTGATGCCGAGGGCAGCAGG - Intergenic
1050422586 9:5482346-5482368 CATGGCATGGATAGGGCTGCAGG - Intergenic
1050457074 9:5844707-5844729 AAGGGGATGAGGAGGGGTGCAGG - Intergenic
1051518505 9:17957821-17957843 CAAGAGATGCTAAGGGCTGCTGG + Intergenic
1051610406 9:18956464-18956486 CAGGGGATCCAGAAGACTGGTGG - Intronic
1052774667 9:32721536-32721558 CATGGGAAGCTGACGGCTGCTGG - Intergenic
1053495495 9:38545634-38545656 CAGGGGCTGCTGAGCACTGCTGG - Intronic
1056658749 9:88529555-88529577 CTGGGGAGGGAGTGGGCTGCAGG - Intergenic
1057325744 9:94061750-94061772 CTGGGGCTGCACAGGGCAGCAGG + Intronic
1057493678 9:95542978-95543000 CTGAGGATGCGAAGGGCTGCTGG + Intergenic
1057561530 9:96131563-96131585 CAGGGGAGGCACAGGCCTGTGGG + Intergenic
1057870818 9:98715817-98715839 CAGGGGATGCAGCAGGGTTCAGG - Intergenic
1059452084 9:114376844-114376866 CTGGGGATTCAGGGGGCTGATGG + Exonic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1060259439 9:122061076-122061098 CAAGTGATGCCAAGGGCTGCTGG - Intronic
1060416742 9:123436040-123436062 CAAGGGGTGCCCAGGGCTGCCGG + Intronic
1060840151 9:126786563-126786585 CTGGAGAGGCAGAGGACTGCAGG - Intergenic
1060977676 9:127774555-127774577 GAGGGGCTGAAGAGGGCTGGCGG + Intronic
1061201688 9:129141815-129141837 CATGGCAGGCAGAGGGCTGTCGG + Intronic
1061990685 9:134157077-134157099 CGGCGGCTGCAGAGGGCAGCCGG - Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062263614 9:135676279-135676301 GTGGTGATGCAGAGGGCTGGGGG + Intergenic
1062615329 9:137393581-137393603 CAGTGGGTGCTGAGGGCTGTGGG - Intronic
1062671495 9:137712413-137712435 CAGCAGTTGCAGAGGGCTCCAGG + Intronic
1062730000 9:138103430-138103452 CTGGGGCCTCAGAGGGCTGCTGG + Intronic
1202800944 9_KI270719v1_random:174916-174938 CAGTGGCTGCAGAGGGCCCCTGG + Intergenic
1188049953 X:25472838-25472860 CTGGGGATACAGGAGGCTGCTGG - Intergenic
1188397987 X:29708386-29708408 CAGAGGCTGCAGAGGGGGGCAGG - Intronic
1189891741 X:45610226-45610248 GCTGGGATGCACAGGGCTGCTGG + Intergenic
1190066672 X:47246089-47246111 GAGGGGATGGAGAGGGATGGTGG - Intronic
1190998796 X:55637550-55637572 AAGGGGGTGCTGAGGGCAGCTGG + Intergenic
1191955998 X:66642764-66642786 AAGGGGATGCTGAGGCCTGTGGG + Intergenic
1193174806 X:78380163-78380185 CAGGGGAAGAAGGGGGCTGAAGG - Intergenic
1194316102 X:92379435-92379457 GAGGGGGTGCTGAGGGCAGCTGG + Intronic
1195709800 X:107764902-107764924 CTGGGGAGGCAGAGGCCTTCGGG - Intronic
1195993155 X:110703215-110703237 CAGGGGATTCTGATGGATGCAGG + Intronic
1197346095 X:125326907-125326929 CACGTGAAGCAGAGTGCTGCTGG - Intergenic
1198300710 X:135331931-135331953 CAGAGGATGCAGCTGGCTGTAGG + Intronic
1198438358 X:136638542-136638564 CAGGGGAGAGAGAGGGCTCCAGG + Intergenic
1199092568 X:143708872-143708894 CAGAGGCTGCAGAGAGCAGCGGG + Intergenic
1199500589 X:148501583-148501605 CCAAGGAAGCAGAGGGCTGCTGG - Intronic
1199679362 X:150214782-150214804 CTGGGGAGGCAGAGGTCTGCTGG - Intergenic
1199695865 X:150342267-150342289 CTGGGGAGGCAGAGGTCTGCTGG + Intergenic
1200043806 X:153388860-153388882 CAGGGGCTGCAGGCGGGTGCAGG + Intergenic
1200100509 X:153687575-153687597 AAGGGGAGGCGGAGGGCTGAGGG + Intronic
1200234351 X:154461014-154461036 AGGGGGATGCAGAGGGAAGCTGG + Intronic
1200624149 Y:5491009-5491031 GAGGGGGTGCTGAGGGCAGCTGG + Intronic
1201140456 Y:11023257-11023279 GAGGGGATGGAGTGGGCTGGCGG - Intergenic
1201291167 Y:12421524-12421546 CGGGGGCTGCAGCGGGGTGCAGG - Intergenic