ID: 1175551572

View in Genome Browser
Species Human (GRCh38)
Location 20:59821346-59821368
Sequence CCTGCTATTTACCCTTATGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175551568_1175551572 12 Left 1175551568 20:59821311-59821333 CCAAAATCAACAAGGACGCAGAC 0: 1
1: 0
2: 2
3: 5
4: 114
Right 1175551572 20:59821346-59821368 CCTGCTATTTACCCTTATGCCGG 0: 1
1: 0
2: 0
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175551572 Original CRISPR CCTGCTATTTACCCTTATGC CGG Intronic
901929176 1:12585939-12585961 CCTGGAATTTACTCTTAAGCAGG + Intronic
913525133 1:119684082-119684104 CCTGATATCTACCCTCAGGCTGG - Intronic
920872278 1:209804973-209804995 CCTGCAGTTTACCCCTAAGCAGG - Intronic
921443685 1:215219504-215219526 TGTGCTATTTAGCCTTATGTTGG - Intronic
1069702697 10:70438340-70438362 CCTGCTCTTAACCATTAAGCAGG - Intronic
1075240798 10:120776675-120776697 GCTGCTTTGTACCCTTAGGCTGG - Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1078734580 11:14008346-14008368 CCTACCATTTACACTTATGCAGG + Intronic
1080597520 11:33787474-33787496 CCTGCCTTTTCCCCTTTTGCTGG + Intergenic
1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG + Intronic
1086982910 11:93218228-93218250 TCTGCTATTTAAGCTTATGCTGG + Intergenic
1088905063 11:114149050-114149072 TCTGGTATGGACCCTTATGCAGG + Intronic
1090284207 11:125485060-125485082 CCTGCTATTTACTCTTACCTTGG + Intronic
1090332755 11:125944376-125944398 CCTGCTCTTTCCCCTTAGGAAGG - Intergenic
1092006040 12:5071296-5071318 CCTGCTCTGTAGCCTTATGCTGG - Intergenic
1093143021 12:15532370-15532392 CTTGCAATTTACACTTATGGTGG + Intronic
1096517621 12:52165808-52165830 CCAGCTATTTTCCCTCAGGCCGG + Intergenic
1096685506 12:53285970-53285992 CCTGCTGCTTCCCCTTCTGCAGG - Exonic
1101896510 12:108761059-108761081 CCTGCTGTTCATCCTTAGGCCGG - Intergenic
1104058535 12:125248824-125248846 GCTGCTTTTTCCCCTTCTGCAGG + Intronic
1107748308 13:43536775-43536797 CCAGCTGTTCACCCTTATGCTGG + Intronic
1108060580 13:46529076-46529098 CCTTCTATTTGCCCTTCTTCTGG + Intergenic
1111677033 13:91399651-91399673 CCTGCGATATACCCCTTTGCTGG + Intronic
1119630027 14:76222304-76222326 CCTTCTATTTACTCTTGAGCTGG - Intronic
1123697164 15:22887134-22887156 CCTGCTTTGTACCCCTTTGCTGG + Intronic
1124202250 15:27688411-27688433 CCTGCTATTTTCCAGTATGAAGG + Intergenic
1125026507 15:35035656-35035678 CCTGTTATCTACACTGATGCTGG - Intergenic
1128859069 15:71050151-71050173 CCTGCTATTCACCTATATGGAGG + Intronic
1128869637 15:71143984-71144006 CCTGCTAATTTCCCTTCTGTGGG - Intronic
1132642315 16:983448-983470 CCTTCTATTTCCCCCTATTCCGG - Intronic
1133284449 16:4684073-4684095 CCTGCTATTGACCGTGAAGCAGG + Intronic
1133896139 16:9930909-9930931 CCTTCTATTTCCCTTTCTGCAGG + Intronic
1135072030 16:19360561-19360583 CCTGCTATGTCCCCAGATGCTGG + Intergenic
1136527284 16:30840006-30840028 CCTGATGTTTACTTTTATGCAGG + Intronic
1137302811 16:47169709-47169731 CCTGCTATTCACCTTTTTACTGG - Intronic
1137734029 16:50711126-50711148 CCTGCTCTTCAACCTTCTGCAGG + Exonic
1138657215 16:58498406-58498428 CCTGCTATGTACACTATTGCTGG - Intronic
1139496359 16:67322034-67322056 CTTTATATTTATCCTTATGCTGG - Intronic
1148458267 17:47822437-47822459 CCTTCCCTTTACCCTTCTGCTGG + Intergenic
1150176435 17:63061725-63061747 ATTCCTATTTATCCTTATGCTGG + Intronic
1152043450 17:77920178-77920200 CCTGCAATTTTCCCAAATGCAGG + Intergenic
1157490150 18:48117497-48117519 CCTGCTATGTGACCTTAGGCAGG + Intronic
1159060243 18:63506883-63506905 CCTGCTATTTACCCATTTGGAGG - Intergenic
1159393184 18:67821989-67822011 CCTACTATTTTCCCTTAGCCTGG + Intergenic
1164483782 19:28637439-28637461 CCTGCCATTTACCCCTCTGCAGG + Intergenic
1168014496 19:53561465-53561487 CCTCCTCTTTGCCCTTAAGCAGG + Intronic
926127882 2:10283081-10283103 CCTGCTGTTTCCCCTAATGCAGG - Intergenic
926735034 2:16067321-16067343 CCTCGTATTTACCTTCATGCCGG + Intergenic
928820057 2:35350898-35350920 TCTGCTTTTTATCCATATGCAGG - Intergenic
928851137 2:35748377-35748399 ACTTCTATTTACCATTGTGCTGG + Intergenic
940774639 2:157874178-157874200 TCTGCTATTACCCCTTATGCAGG - Intronic
947142827 2:227035130-227035152 ACTCCTATTTACCCTTGAGCAGG - Intronic
1169843073 20:9960972-9960994 CCTCCTATTTACTCTTTTGCTGG - Intergenic
1173341452 20:42156182-42156204 CTGGCTATTTACCTTTAGGCTGG + Intronic
1175037140 20:56010379-56010401 GCTGCCATTTTCCCTCATGCGGG - Intergenic
1175551572 20:59821346-59821368 CCTGCTATTTACCCTTATGCCGG + Intronic
1175867794 20:62190629-62190651 CCTGCTTTTAACCATTATGTAGG - Intronic
1180849137 22:19004053-19004075 CCTGCTTTTTTCCCTTAGGGTGG + Intergenic
1181664389 22:24382237-24382259 CCTGCTTTTTTCCCTTAGGGCGG + Intronic
955520287 3:59769063-59769085 CCTTTTATTTGCCCTTCTGCTGG - Intronic
962122542 3:132577477-132577499 CCTGCTCTTTCCCCTCAAGCAGG - Intronic
964402660 3:156315215-156315237 CCTGCTTTTTTCTCTTATGGTGG + Intronic
966579883 3:181549057-181549079 CCTGCTATTCAACATTGTGCTGG - Intergenic
966818567 3:183908127-183908149 CCTGCTACTTACCCTGCTCCTGG + Intergenic
974334295 4:60520415-60520437 CCTACTCTTTTCCTTTATGCTGG - Intergenic
978464256 4:108991187-108991209 CGTGTTATTTACCTTTATTCAGG + Intronic
978789740 4:112648687-112648709 CCTGCCTTTTACCCTTCTGGAGG - Intronic
979187352 4:117813734-117813756 CCTGCTTTTCTCCTTTATGCTGG - Intergenic
980965894 4:139520885-139520907 CCTGTTATGAACCCTTTTGCTGG - Intronic
982627966 4:157791922-157791944 CCTGCTATTTACCACTGTCCAGG + Intergenic
990224908 5:53639023-53639045 CCTGCTTTTTTCTCTTATTCTGG + Intronic
1001669970 5:173465730-173465752 CCTGTTAATTACCCTGAAGCAGG + Intergenic
1005498216 6:26407332-26407354 CCTGCAAGTTACCCTCAGGCTGG + Intronic
1007489504 6:42207841-42207863 TTTGCTATTTACCTTTGTGCAGG - Exonic
1008304177 6:49881153-49881175 ACTGCTATTTAACATAATGCTGG - Intergenic
1012256340 6:97036906-97036928 CCTGCTCTTTTCCCCTATGGGGG + Intronic
1017549881 6:155494876-155494898 CCTTCTTTTTACCCTTCAGCTGG - Intergenic
1019648826 7:2145287-2145309 CCTGCTTGTTAGCTTTATGCGGG - Intronic
1022186499 7:27974586-27974608 CCTGCTATATACTTTTATGTAGG + Intronic
1022664368 7:32396770-32396792 CCTGTGATTTATTCTTATGCTGG - Intergenic
1023035271 7:36126259-36126281 CTTGCTATTTCCTCTTATCCAGG + Intergenic
1027520524 7:79200862-79200884 CCTGCTATTGATGCTAATGCTGG - Intronic
1031461040 7:122049305-122049327 CCTGCTATTCAACATTATTCTGG + Intronic
1031716565 7:125115840-125115862 CCTTCTATTTATTCTTATACTGG - Intergenic
1036613620 8:10371505-10371527 GCTGCTGTTTACTTTTATGCAGG - Intronic
1039111112 8:34041424-34041446 CCTGCAATCTACCATAATGCAGG - Intergenic
1039383790 8:37112116-37112138 CCTGCCATTTACCCTCAAGTAGG - Intergenic
1050855378 9:10347708-10347730 CCAGCTATTTGTCTTTATGCTGG + Intronic
1051286336 9:15501136-15501158 CCTGCTATATAACCTTGGGCAGG - Intronic
1051387721 9:16527563-16527585 CCTGCTATTGAAGCTTATGCAGG - Intronic
1053402354 9:37836834-37836856 TTTGCTATTTACCTTTGTGCAGG + Intronic
1186522094 X:10214832-10214854 CCTCCTGTTTACCCTTCTGTTGG - Intronic
1188152406 X:26694569-26694591 ACTGCTCTTTTCCCTTCTGCTGG - Intergenic
1192981470 X:76349117-76349139 CCTGCTTTTTAGCTTTATGAGGG + Intergenic
1193644929 X:84056075-84056097 CCATCTATTTGCCCTTATTCTGG + Intergenic
1196222286 X:113125652-113125674 CCTGATATTTACCTTTATCTTGG - Intergenic
1196687478 X:118524261-118524283 CCTCCTTTTTACCCTTCTGTGGG - Intronic