ID: 1175554657

View in Genome Browser
Species Human (GRCh38)
Location 20:59840977-59840999
Sequence ATGGAGCAGCACAACGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175554657_1175554659 19 Left 1175554657 20:59840977-59840999 CCTTCTTCGTTGTGCTGCTCCAT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1175554659 20:59841019-59841041 ACAGAATATCCTTCCTAAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175554657 Original CRISPR ATGGAGCAGCACAACGAAGA AGG (reversed) Intronic
900622853 1:3595349-3595371 ATGCAGCAGCCCGACGAGGAGGG - Exonic
901473772 1:9475225-9475247 ATTGAGCAACCCAAGGAAGAGGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
904273021 1:29362785-29362807 GTGGAGCAGAACAAGGATGAGGG - Intergenic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
910451991 1:87356677-87356699 ATGGTGAAGCAAAACAAAGATGG + Intergenic
911766195 1:101678003-101678025 AAGGAGCAGCATAAAGAAAATGG + Intergenic
913049400 1:115103794-115103816 CTGTAGCAACACAAGGAAGAAGG - Intergenic
913374882 1:118140071-118140093 ATGGAGTCGCACCAGGAAGAAGG + Intronic
920975068 1:210778105-210778127 ACTGAGCAGGACAACTAAGATGG - Intronic
921891670 1:220360026-220360048 ATGGAGCAGAGCACAGAAGATGG - Intergenic
922615503 1:226958858-226958880 ATGGAGCAGCAGGAAGAAGTAGG + Intronic
924202384 1:241673484-241673506 ATGGAGCAGGATAAGGCAGAGGG - Intronic
924345052 1:243065917-243065939 ACGGACCTGAACAACGAAGATGG - Intergenic
924496265 1:244593077-244593099 CTGGAATAGCACAACGAACATGG + Intronic
1064299680 10:14112343-14112365 ATGGAGGAGCACAGAGGAGAGGG + Intronic
1067264524 10:44726859-44726881 TTGGAGAAGAACAAAGAAGAAGG - Intergenic
1067793692 10:49305930-49305952 ATGGAGCAGTACATATAAGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070438039 10:76412827-76412849 ATTTAGCAGCAAAACAAAGAAGG - Intronic
1071201733 10:83227152-83227174 AAGGAGCAGCTCAACCAAGCAGG - Intergenic
1071276165 10:84057461-84057483 ACACAGCAGCACAAAGAAGAGGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071502045 10:86211100-86211122 ATGGAGCAGCCCTGTGAAGAGGG - Intronic
1072433234 10:95392156-95392178 CTGGAGCAGCACCACGGACAGGG + Intronic
1074673102 10:115818053-115818075 ATGGAGCAGCTAAAAGAGGAGGG - Intronic
1076865965 10:133166331-133166353 GGGGAGCAGCACACCCAAGAGGG + Intronic
1086778389 11:90869638-90869660 ATGGAACAGCAAAACCTAGATGG + Intergenic
1088585621 11:111357823-111357845 ATGGGGCAGCACCACCTAGAGGG + Exonic
1091167278 11:133490862-133490884 ATGGAACAGCATAACGTTGACGG - Intronic
1097057123 12:56257026-56257048 AGGCAGCAGCACGATGAAGAGGG + Exonic
1104250738 12:127091057-127091079 ATGGAGCAGCACCACTAGGATGG + Intergenic
1108249459 13:48550544-48550566 ATGGAGCAGAGCATCCAAGAAGG + Intergenic
1109551401 13:63906072-63906094 ATGCAGAAGCACAGCGAACAGGG + Intergenic
1110391383 13:74978765-74978787 AGGGTGCAGCAGACCGAAGAGGG + Intergenic
1119612286 14:76073822-76073844 AGGGAGCAGCACAACAATCAAGG - Intronic
1125664623 15:41420475-41420497 ATGGAGCAGCACAAGGTATTTGG - Intronic
1127126661 15:55818920-55818942 AGGGAGAAGCACAATGAAAATGG - Intergenic
1127734863 15:61831008-61831030 TTTGAGCAGCACAAGGAAGCAGG + Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1142930719 17:3282022-3282044 ATGGAGAAAAACAATGAAGAGGG - Intergenic
1143296142 17:5873419-5873441 ATGGAACAGAAGAAGGAAGAAGG - Intronic
1152667949 17:81582199-81582221 CTGCAGCAGCACAACCAGGAGGG + Intronic
1155692779 18:28647592-28647614 ATGGGGCAGGACAATAAAGATGG + Intergenic
1158682905 18:59584671-59584693 ATGGTGAAGCACAAGCAAGAGGG - Intronic
1159303616 18:66611312-66611334 AGGGAGCAACACAAAGAATAAGG + Intergenic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1162616927 19:11809395-11809417 ATGGAGCAGGACAAAAACGAGGG - Intronic
1164704281 19:30308520-30308542 CTGGAGCAACAAAACCAAGATGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
925222567 2:2153857-2153879 AGGGAACAGCAGAACGAACACGG + Intronic
926946219 2:18190236-18190258 TTGGAGCAGAATAAAGAAGATGG + Intronic
927395968 2:22651582-22651604 CTGGGGCAGCACAAAGAAGTAGG + Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930449069 2:51511265-51511287 ATGGAGCAGCTGAACAGAGAGGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935944545 2:108273563-108273585 AAGGAGCAGCAGCACGAAGAGGG - Intergenic
936741044 2:115509026-115509048 TGGGAGCAGCACAAGGAAGGGGG + Intronic
944031234 2:195237199-195237221 ATAGAGAAGCACAAATAAGAGGG - Intergenic
945502449 2:210592901-210592923 GTGGAACTGCACAGCGAAGAAGG - Exonic
945976897 2:216277923-216277945 TTGGAGCAGCAGACAGAAGAGGG - Intronic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
1170000336 20:11607786-11607808 ATGTACCAGCAAAACCAAGATGG + Intergenic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1175554657 20:59840977-59840999 ATGGAGCAGCACAACGAAGAAGG - Intronic
1176180750 20:63748260-63748282 ATGGGGCAGCACCCTGAAGAGGG + Intronic
1181720838 22:24773199-24773221 ATGGAGCATCACAGCAGAGATGG - Intronic
1183593977 22:38798563-38798585 ATGGAGCAGCAAGAAGAAGATGG - Intergenic
1185188538 22:49418009-49418031 GGGGAGCAGCACCAGGAAGACGG + Intronic
949171842 3:1009223-1009245 ATGTAGCTGCACAATGAAGAAGG - Intergenic
953418828 3:42739399-42739421 ATGGAGCAGCACCAGGCACAAGG - Intronic
961521223 3:127468394-127468416 ATGGAGCAGGACGAGGAAGCAGG + Intergenic
961935197 3:130575636-130575658 ATGGAGGAGCACCTGGAAGATGG - Intronic
968247605 3:197168701-197168723 ATGGAGCAAAACAAGGATGATGG - Intronic
969483886 4:7460976-7460998 AAGGAGCAGCACGAGGATGATGG - Intronic
973692586 4:53452930-53452952 AAGGAGCAGAACCAGGAAGATGG - Exonic
977984458 4:103365685-103365707 ATGGTGTAGCACAAATAAGAAGG + Intergenic
978408370 4:108403387-108403409 ATGGAGCAGCAACATGTAGAGGG - Intergenic
984535534 4:180970070-180970092 AAGTAGCAGCAAAAAGAAGAGGG - Intergenic
985988021 5:3533588-3533610 ATGGAGCAGCCCCACTAAGGAGG - Intergenic
986309706 5:6543145-6543167 ATGGAGCAGCCCAAGGACCAAGG - Intergenic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
992941926 5:81771212-81771234 AGGGAGCAGAACGAGGAAGACGG - Intergenic
993026279 5:82650799-82650821 AAGGAGCAGGACAATGAAGTAGG - Intergenic
996608081 5:125347180-125347202 ATGTTGCAGCAAAAAGAAGAAGG + Intergenic
998013720 5:138715947-138715969 ATTGGGCAGCATATCGAAGAAGG - Intronic
1005558781 6:27015981-27016003 TTGAAGCAGCACAAGGCAGATGG - Intergenic
1009961464 6:70527764-70527786 AAGAAGGAGCAGAACGAAGAGGG - Intronic
1013038905 6:106414297-106414319 AAGAAGCTGCACAAGGAAGATGG + Intergenic
1014910624 6:127088570-127088592 CAAAAGCAGCACAACGAAGAAGG - Intergenic
1015078734 6:129196809-129196831 ATGGAGTAGAACCAGGAAGAAGG + Intronic
1015180398 6:130355744-130355766 ATGGAGAAGCACCAGTAAGAGGG + Intronic
1017542680 6:155418703-155418725 ATGCAGGAGCACAACCAATAAGG - Intronic
1022178583 7:27896087-27896109 AGAGAGCAGCACAAGGAAGGAGG + Intronic
1023372056 7:39521573-39521595 ATGGAGCAGGAAAACTAAGAGGG + Intergenic
1025813707 7:64890866-64890888 ATGGAGCAGAGCAACGGTGAAGG - Intronic
1026553872 7:71389703-71389725 TTGGAGAAGGACAACAAAGATGG - Intronic
1031071117 7:117162983-117163005 ATGGAGAAGCAAAACAAAGTTGG - Intronic
1034001952 7:147424113-147424135 ATGGAGCAGCGGAATGAAGTAGG - Intronic
1034788066 7:153943457-153943479 ATGGAGAAGGACAAAAAAGAGGG - Intronic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1041911408 8:63092662-63092684 ATGCAGGACCACAACAAAGATGG + Intergenic
1045316984 8:101052058-101052080 GTGGAGCAGCATAAAGATGAAGG - Intergenic
1046743605 8:117853863-117853885 ATTGAGCATCTCTACGAAGAAGG + Intronic
1047184602 8:122621206-122621228 ATGGTGGAGCACAAGGTAGATGG + Intergenic
1047336245 8:123939483-123939505 AAGGAGCAGGACAAGCAAGAAGG + Intronic
1047787364 8:128167026-128167048 TTGGAGTGGCACAACGACGAAGG - Intergenic
1048607946 8:135989694-135989716 ATGGGGCAGCACAGTGAAGATGG - Intergenic
1053052270 9:34971720-34971742 AGGGAGCAGGACAGGGAAGATGG + Intronic
1057414121 9:94846225-94846247 CTGGAGAAGCACAACGTGGAAGG + Intronic
1059070775 9:111133687-111133709 ATGTAGCTGCACAAAGAAGGAGG + Intergenic
1061036813 9:128118787-128118809 ATGGAGGGGTACAACGAAGGAGG + Intergenic
1062115397 9:134805715-134805737 ATGGAGGAGCACAGCAGAGAGGG + Intronic
1188929203 X:36085400-36085422 ATGGAGCAGCACATCATAAATGG - Exonic
1189760880 X:44320360-44320382 CTGGAGCAGAACAAGGGAGAAGG + Intronic
1193827431 X:86242844-86242866 ATGGAGCAGGAGAAAGAAGGGGG - Intronic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196466743 X:115979661-115979683 AAGTATCAGCACAATGAAGAGGG + Intergenic
1199713783 X:150491579-150491601 ATGGAGGACCACAAAGAAGCAGG + Intronic
1201961192 Y:19682316-19682338 AGGGAGGAGAACAAGGAAGAAGG - Intergenic