ID: 1175560800

View in Genome Browser
Species Human (GRCh38)
Location 20:59927958-59927980
Sequence GCATTTTTCACCTTCCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175560800_1175560806 20 Left 1175560800 20:59927958-59927980 CCAGGGTGGAAGGTGAAAAATGC 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1175560806 20:59928001-59928023 CAATTACCTTGCAGTGCCTTGGG 0: 1
1: 0
2: 0
3: 10
4: 133
1175560800_1175560805 19 Left 1175560800 20:59927958-59927980 CCAGGGTGGAAGGTGAAAAATGC 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1175560805 20:59928000-59928022 TCAATTACCTTGCAGTGCCTTGG 0: 1
1: 0
2: 1
3: 8
4: 126
1175560800_1175560804 -10 Left 1175560800 20:59927958-59927980 CCAGGGTGGAAGGTGAAAAATGC 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1175560804 20:59927971-59927993 TGAAAAATGCAGGGCTGGAAAGG 0: 1
1: 0
2: 4
3: 30
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175560800 Original CRISPR GCATTTTTCACCTTCCACCC TGG (reversed) Intronic
904009958 1:27383740-27383762 GCTTTGTACACCCTCCACCCAGG + Intergenic
904272981 1:29362556-29362578 ACCTCATTCACCTTCCACCCCGG - Intergenic
905367431 1:37461085-37461107 CCATTTTCCACCTACCAGCCTGG + Intergenic
906438253 1:45815898-45815920 GCATGATTCACCTTCCTCCTAGG - Intronic
908129705 1:61062895-61062917 TCATTTTTCAGCTTTCAGCCTGG + Intronic
908500069 1:64734191-64734213 TCATTTCTCACATTCCACTCGGG + Intergenic
908705499 1:66949789-66949811 GTGTTTTTCACCTTACACCTTGG + Intronic
913130661 1:115835582-115835604 GTATTCTTCACTTTTCACCCAGG - Intergenic
921498671 1:215872895-215872917 TCCCTTTTCACCTTCCACCACGG + Intronic
1066950364 10:42111440-42111462 GCATTTTGCACCCGCCACCAGGG - Intergenic
1067467177 10:46509976-46509998 GCATTATCCACTTTCCACCAAGG + Intergenic
1067620009 10:47874629-47874651 GCATTATCCACTTTCCACCAAGG - Intergenic
1068669935 10:59712090-59712112 GCAATTTTCACATTCCAGCCTGG - Intronic
1069770086 10:70893086-70893108 GAAGTATTCACCTTCCATCCAGG + Intergenic
1069910288 10:71754580-71754602 ACATCTTTCACCTCCCACCCTGG - Intronic
1070156325 10:73837807-73837829 GCCTTTGACAGCTTCCACCCAGG + Intronic
1074211166 10:111336474-111336496 GCCTTTTGCCCCATCCACCCTGG - Intergenic
1076106538 10:127827827-127827849 GATTTTTTCAGCTGCCACCCAGG - Intergenic
1076300158 10:129419588-129419610 TCATCTTTCACCTTCCTGCCTGG - Intergenic
1079245169 11:18746776-18746798 TCCTTTTTCACCTTGCTCCCAGG - Intronic
1079521294 11:21329337-21329359 GCTTGTTTCCCCTTCCACCATGG + Intronic
1080328642 11:31109357-31109379 GGATTTTTCACCTGTCTCCCCGG - Intronic
1085065972 11:73496302-73496324 TCCCTTTTCACCTTCCACCTTGG - Intronic
1085604339 11:77883795-77883817 GCATATTTCCCTTCCCACCCTGG + Intronic
1086389059 11:86342295-86342317 GCATTTTTCTCCTTCTAGCATGG + Intronic
1089850156 11:121488687-121488709 GTATTTTCCTCCTTCAACCCAGG + Intronic
1094611940 12:32002984-32003006 GCCTTTTTCCCCAGCCACCCTGG + Intergenic
1095433486 12:42161152-42161174 GCTTTTATCACCTTCCTCCATGG - Intronic
1099566010 12:84247034-84247056 TCCTCTTTCACCTTCCACCGTGG + Intergenic
1101697802 12:107142739-107142761 GAGTTCTTCACCTTCCAGCCAGG + Intergenic
1104711356 12:130989069-130989091 ACATCTTCCAGCTTCCACCCAGG + Intronic
1108179601 13:47827758-47827780 ACATTTTTCAACTCCCACCATGG + Intergenic
1109123827 13:58491873-58491895 CCATTTTTCACTTTCCACATTGG - Intergenic
1110781623 13:79472566-79472588 GCATTATTCTCCTTCCAGCTGGG - Intergenic
1114955685 14:27815481-27815503 GCTTTTTTCTCCTTTCACTCAGG - Intergenic
1117582015 14:57160922-57160944 CCACTATTCTCCTTCCACCCTGG + Intergenic
1121022414 14:90588432-90588454 CCATTTTTCAATTTCCACCTTGG - Intronic
1121599247 14:95190957-95190979 ACAGCTTTCACCTTCCTCCCTGG + Exonic
1122879171 14:104682327-104682349 GAATCTGTCACCTCCCACCCTGG + Intergenic
1124150310 15:27171959-27171981 GCATGTGACACCTTCCACCTCGG - Intronic
1125447257 15:39771459-39771481 GCACTGTCCATCTTCCACCCTGG - Intronic
1125842533 15:42817746-42817768 GCATTTGTCTCCTTCCACAATGG + Intronic
1128060836 15:64734852-64734874 CCTTCTTTCACCTTCCTCCCAGG + Intergenic
1133462318 16:5997609-5997631 TCATTTATCACCTGCAACCCAGG - Intergenic
1134363235 16:13552382-13552404 GTATTTTTAAGCTTCCACCGAGG + Intergenic
1136047451 16:27625746-27625768 ACATTTATCACCTTCCACACTGG + Intronic
1136713225 16:32257297-32257319 CCCTTTGTCATCTTCCACCCAGG - Intergenic
1136754687 16:32672130-32672152 CCCTTTGTCATCTTCCACCCAGG + Intergenic
1136813425 16:33198234-33198256 CCCTTTGTCATCTTCCACCCAGG - Intronic
1136819901 16:33308314-33308336 CCCTTTGTCATCTTCCACCCAGG - Intergenic
1136826465 16:33364854-33364876 CCCTTTGTCATCTTCCACCCAGG - Intergenic
1136831531 16:33463625-33463647 CCCTTTGTCATCTTCCACCCAGG - Intergenic
1136997910 16:35203300-35203322 CCCTTTATCATCTTCCACCCAGG + Intergenic
1137028780 16:35502960-35502982 CCATTTATTATCTTCCACCCAGG + Intergenic
1137084445 16:36102254-36102276 GCTTTTTACACCCTCCGCCCCGG - Intergenic
1141466869 16:84211853-84211875 GCATCTTTCCCCTGCCTCCCTGG - Intergenic
1141616265 16:85211425-85211447 GCAGTTCTCACACTCCACCCAGG - Intergenic
1202992002 16_KI270728v1_random:21209-21231 CCCTTTGTCATCTTCCACCCAGG - Intergenic
1203056833 16_KI270728v1_random:932465-932487 CCCTTTGTCATCTTCCACCCAGG + Intergenic
1147608040 17:41785442-41785464 GCACTTTCCACCCCCCACCCCGG + Intronic
1150114216 17:62530715-62530737 GCATCCTACACCTTCCACCTGGG + Intronic
1150155330 17:62848379-62848401 TCACTTTTAACCCTCCACCCTGG - Intergenic
1150429599 17:65104575-65104597 GCTTTCTTGACATTCCACCCAGG - Intergenic
1151195960 17:72431202-72431224 GTATTTTTCCCTCTCCACCCTGG - Intergenic
1152650411 17:81490010-81490032 TCATTTCTCACCTTCCAAACTGG + Intergenic
1152704454 17:81835488-81835510 TCAGTTTTCACCTTCCAGCGTGG + Intergenic
1153144260 18:2011953-2011975 GCATTTTTCACCTCTCCCCAAGG + Intergenic
1155194140 18:23457177-23457199 GCATTTTGTAACTTGCACCCTGG - Intronic
1155425078 18:25698570-25698592 TCCTTTTTCACCTACCACTCTGG + Intergenic
1155994034 18:32311495-32311517 GCATTTCTCACCTTCTACCATGG - Intronic
1158238083 18:55342099-55342121 GCTTTTTTCCCCTTCTACCTGGG + Intronic
1165139540 19:33690479-33690501 GCTCTTTTCACCTTCCTTCCTGG - Intronic
1165798278 19:38532023-38532045 GCATTTGTCACAAGCCACCCTGG + Intronic
926255120 2:11187107-11187129 CCATTTTTCACCTGCCAAACTGG - Intronic
927427868 2:23001393-23001415 GTACTTTTCACTTTCCATCCTGG + Intergenic
927471075 2:23377320-23377342 GCACTGTTCAACTTCCACTCTGG + Intergenic
928316833 2:30252889-30252911 GCATTTCTCACCCTCAGCCCAGG - Intronic
928468986 2:31554715-31554737 GCATTTTTCACCTGGCTCTCTGG + Intronic
929120090 2:38477142-38477164 GCATTGGTCACCTTCATCCCAGG - Intergenic
929454148 2:42054579-42054601 GCACTTTTCCCTTCCCACCCAGG + Intronic
930584107 2:53249508-53249530 GCATTTCCCACCTTACATCCAGG - Intergenic
931189531 2:59986696-59986718 GGATTTTTCACTTTCCATCTGGG - Intergenic
932923748 2:75946163-75946185 GCAGTTTTCAACTTCCATTCAGG + Intergenic
934481595 2:94652580-94652602 GCTTTTTTCTCCTTTCACTCAGG + Intergenic
936024632 2:109021882-109021904 CGATTTTTCACCTTCCACCAGGG + Intergenic
937778084 2:125804997-125805019 CCATTTCTCAATTTCCACCCGGG - Intergenic
938251240 2:129817230-129817252 GCACTGGGCACCTTCCACCCTGG + Intergenic
939762483 2:146199740-146199762 GCACTTTACACTTTCCACACAGG - Intergenic
941816701 2:169803155-169803177 GCATTTTTCACCTAACAAACTGG - Intronic
941925978 2:170895378-170895400 GCAGTTTTCACATTTCGCCCTGG + Intergenic
946554215 2:220836562-220836584 GCATTTTTTACTTTCCTCTCAGG - Intergenic
947451203 2:230210897-230210919 GGAATTTTCACTTTCAACCCTGG - Intronic
1172507681 20:35475714-35475736 TCATTCTTCACCTTCAAGCCAGG + Intronic
1173864135 20:46303411-46303433 GAATTGTTCATCTTCCTCCCTGG + Intronic
1175560800 20:59927958-59927980 GCATTTTTCACCTTCCACCCTGG - Intronic
1179663313 21:42892373-42892395 GCATCTGCCACCATCCACCCTGG - Intronic
1184021581 22:41825223-41825245 GCATTCTTCAACTGCAACCCAGG - Intronic
1184939360 22:47749793-47749815 ACACTCTTCACCTCCCACCCAGG + Intergenic
949140704 3:629347-629369 GCATTTTTGTCCTTCCACCATGG - Intergenic
950809841 3:15640989-15641011 GCCTTCTCCACCTTCCTCCCTGG + Intronic
953543310 3:43841675-43841697 GCATTTTTCTCCCTCCACAGTGG - Intergenic
956142838 3:66162978-66163000 CCTTATTTCACCTTTCACCCTGG + Intronic
958639046 3:96780763-96780785 GCACCTTTCACCTTCCATCATGG + Intergenic
961248939 3:125482909-125482931 ACATTTTCCACCTTCCATCTTGG - Intronic
962945026 3:140160537-140160559 GCATTTTTCTCATTCCATGCTGG + Intronic
964768956 3:160204494-160204516 GTTTCTTTCACCTTCCACCATGG - Intergenic
968606871 4:1539740-1539762 TCCTTTGTCTCCTTCCACCCTGG + Intergenic
969582212 4:8072011-8072033 GCAGTTCCCACCTTGCACCCGGG + Intronic
971328166 4:25661343-25661365 GCGTGTTTTACCTACCACCCAGG - Intronic
971366673 4:25983238-25983260 TCACGTTTCACCTTCCACCATGG - Intergenic
971809057 4:31399698-31399720 TCATTGTTCACCTTCCACTTAGG + Intergenic
974452287 4:62080900-62080922 ACATTTTTCACCTAACACGCTGG - Intergenic
975915026 4:79314492-79314514 GCATTTTTAACATAGCACCCAGG + Intronic
978854859 4:113382767-113382789 GCACTTTTCACTTTCCAGCTAGG + Exonic
980480007 4:133376144-133376166 GCATTTCTCACCTGTCACCCGGG - Intergenic
981058824 4:140397271-140397293 CCATTTTTCACCTACCACATGGG - Intronic
982229017 4:153191444-153191466 GCATTTTTAAGCATCCACTCGGG - Intronic
985999639 5:3620370-3620392 GCAGCTTTCACCTTCCAACACGG - Intergenic
996550079 5:124721442-124721464 GCATGTTTCCCCTGCCAGCCTGG - Intronic
997258790 5:132449560-132449582 TCATCTTTCAACTTCCATCCAGG + Intronic
998954118 5:147420836-147420858 TCATCTTACACCTTCAACCCTGG + Intronic
1000188788 5:158887905-158887927 TCATTCTTCACCTTAAACCCTGG - Intronic
1000693496 5:164351175-164351197 GCCTCTTTCACCTTTCACTCAGG - Intergenic
1004703894 6:18104792-18104814 TCCTTCTTCACCTTCCACCATGG - Intergenic
1005579342 6:27218612-27218634 CAATTTTTCACCTTCTACCGTGG - Intergenic
1005931964 6:30490918-30490940 TCCCTTTTCACCTTCTACCCTGG + Intronic
1006937455 6:37728332-37728354 GCAGATCTCACCTTCCACACAGG + Intergenic
1009653351 6:66506038-66506060 GCATTCTTCCCCTTCAACCATGG - Intergenic
1010627265 6:78153756-78153778 CCATTTGTTACCTTCCACTCTGG + Intergenic
1010992453 6:82494970-82494992 GGATTTTTAACTTTCCATCCTGG + Intergenic
1011657904 6:89568019-89568041 GCAGTTTTCACATTCCATGCCGG + Intronic
1011965007 6:93144729-93144751 GCATCTTTCTCCTTCCATCATGG + Intergenic
1019202625 6:170330774-170330796 GCCTCTTTCTCCATCCACCCTGG + Intronic
1020113457 7:5461269-5461291 GCATTTTCTTCCTTCCAGCCAGG + Intronic
1021453501 7:20803894-20803916 GCATTTTTGTTCTTCTACCCAGG - Intergenic
1022769792 7:33457010-33457032 ACATTTTCCACCTTGCACCATGG - Intronic
1024307109 7:47938288-47938310 GCATCTTTCAGCTCCCACTCTGG - Intronic
1024566034 7:50681768-50681790 GCATTTTTCACGTTTCACGGGGG + Intronic
1024588200 7:50859092-50859114 GCATTGGACACCTTCCACCATGG + Intergenic
1026394214 7:69935280-69935302 TCCTTTTTCACCTTGGACCCTGG - Intronic
1029835169 7:103301691-103301713 GGGTTTTTCACCCTTCACCCTGG + Intronic
1032043918 7:128586484-128586506 GCATCCTACACCTTCCACCTGGG + Intergenic
1032096165 7:128939353-128939375 GCTTCTTTCAGCTTCCTCCCAGG - Intronic
1032657506 7:133947488-133947510 GCCTTTTTCAAATTCAACCCTGG - Intronic
1037838280 8:22227371-22227393 GCATATTTTCCCTTCCTCCCTGG - Intronic
1038169386 8:25115087-25115109 TCATTTTTCACATTCCAGCCAGG - Intergenic
1041128942 8:54675984-54676006 GCCTTTTTGCCCTTCCACCATGG - Intergenic
1041707293 8:60860006-60860028 GCTTTTGTCACTTCCCACCCAGG - Intronic
1041766984 8:61429109-61429131 GCTTTTTTGCCCTTCCACCATGG - Intronic
1042510857 8:69609389-69609411 GCATTTTTCAAGTGCCACCCAGG - Intronic
1044269610 8:90226239-90226261 TCATTTTTCTCCTTCTACCTTGG - Intergenic
1044464458 8:92487436-92487458 TCATTTTTCATCTTTGACCCAGG - Intergenic
1045874149 8:106959347-106959369 GCATTTTTCCCCTCCCACATAGG - Intergenic
1047459857 8:125052665-125052687 GCTTTTTTCATTTTCCACCTTGG + Intronic
1051664709 9:19457798-19457820 TCAGTTTTCACCCCCCACCCCGG + Intergenic
1054773983 9:69109116-69109138 GAAATTTGTACCTTCCACCCAGG - Intergenic
1054968818 9:71061067-71061089 GCATTCTTCAGCTCTCACCCTGG - Intronic
1056679397 9:88704111-88704133 GCATTTTTCACATCCTATCCTGG - Intergenic
1056810843 9:89762766-89762788 GCACTTCCCTCCTTCCACCCTGG - Intergenic
1061456749 9:130703945-130703967 GCACTGTTCATCTGCCACCCAGG - Exonic
1203612346 Un_KI270749v1:21264-21286 GGACTCATCACCTTCCACCCAGG + Intergenic
1193677807 X:84478208-84478230 GAATTTTTCAGGTTCCACTCAGG + Intronic
1195469733 X:105218858-105218880 GCCTTCTTCCCCTACCACCCCGG + Intronic
1196412319 X:115433335-115433357 GCATTTTACACCCACCTCCCTGG - Intergenic
1196630637 X:117935579-117935601 GCCTGTTTCACCTTCCGCCATGG - Intronic
1199480800 X:148296699-148296721 ATGTTTTTCACCTTCCACCAGGG + Intergenic
1201020097 Y:9647355-9647377 GAATTTGTCACCTTACAGCCAGG + Intergenic