ID: 1175561820

View in Genome Browser
Species Human (GRCh38)
Location 20:59937243-59937265
Sequence GGCCAGGGGCGTAGCAGTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 250}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175561820 Original CRISPR GGCCAGGGGCGTAGCAGTGA AGG Exonic
901163525 1:7198589-7198611 GGCCAAGGGGGTATGAGTGATGG - Intronic
901236849 1:7671827-7671849 GGCGAGTGGGGAAGCAGTGATGG - Intronic
901358187 1:8670895-8670917 AGGCAAGGTCGTAGCAGTGAAGG + Intronic
901957815 1:12799088-12799110 GGTCAGGGGTAGAGCAGTGAGGG - Intergenic
902830933 1:19012066-19012088 TACCAGGGGCAGAGCAGTGAGGG + Intergenic
903022326 1:20403067-20403089 GCCCAGGGGAGGGGCAGTGAGGG - Intergenic
904403830 1:30273632-30273654 GGCCAGGCATGGAGCAGTGAGGG + Intergenic
904638356 1:31902351-31902373 GGCCAGGAGCCAAGGAGTGACGG - Intergenic
904660059 1:32077339-32077361 GGCCAGGTGCTGGGCAGTGAGGG - Intronic
905214999 1:36400717-36400739 TGCCAGGTGTGGAGCAGTGAGGG + Intergenic
905284457 1:36870230-36870252 GGCCAGGGGGTTAGCAGGGTTGG - Intronic
905659401 1:39709838-39709860 GGCCAGGGTCGCAGAAGGGAGGG - Intronic
907307321 1:53520591-53520613 GGCCAGGGGCGTAGCCCAGGAGG - Intronic
908939018 1:69409962-69409984 GGCCAGGTGCAGAGAAGTGAGGG - Intergenic
910245561 1:85134802-85134824 GACCATGGTGGTAGCAGTGAGGG - Intergenic
910967313 1:92820481-92820503 GACCAGGGCAGTAGCAGTGGAGG + Intergenic
912044605 1:105438046-105438068 AGCCAGGTGAGCAGCAGTGAGGG - Intergenic
914087478 1:144466008-144466030 AGCCAGGGATGTAGCAGTGGAGG + Intergenic
914193254 1:145428983-145429005 AGCCAGGGAGGTAGCAGTGGAGG + Intergenic
914311133 1:146468195-146468217 AGCCAGGGACGTAGCAGTGGAGG - Intergenic
915128053 1:153679386-153679408 GGCCAGGGGCGCTGCGGTGTCGG - Exonic
915139805 1:153760356-153760378 GTCCAGGAGTGTGGCAGTGATGG - Exonic
917795535 1:178530241-178530263 GGCCAGTGCTGTGGCAGTGATGG - Intronic
918126189 1:181586067-181586089 GGCCAGGGAGGTAGCAGCGGAGG + Intronic
919112772 1:193241533-193241555 GGCAATGGCAGTAGCAGTGAAGG + Intronic
920681978 1:208080172-208080194 GGCCAGGTGGCTAGCAGTGAGGG + Intronic
922352739 1:224747715-224747737 GGCCAGGGGAGCAGCAGTTGGGG + Intergenic
923982312 1:239338865-239338887 GGCCAGGGCGGTCTCAGTGAAGG - Intergenic
924544705 1:245015766-245015788 GGCCAGAATGGTAGCAGTGAAGG - Intronic
924599844 1:245478844-245478866 GACCAGGGTGGGAGCAGTGAAGG + Intronic
1063219296 10:3951100-3951122 GGTGAGGGGTGCAGCAGTGAAGG + Intergenic
1066036390 10:31491490-31491512 GCCCTGGGGCATGGCAGTGAAGG - Intronic
1067672110 10:48333006-48333028 GGCAAGGGACATAACAGTGATGG - Intronic
1067789900 10:49279947-49279969 GGCCAGGAGCATAGCAGAGAAGG + Intergenic
1068758335 10:60680330-60680352 GGCCAGGGACAATGCAGTGAGGG + Intronic
1069856443 10:71443575-71443597 GGCCATGGGGGTGGCAGAGAGGG + Intronic
1071166670 10:82815818-82815840 AGCCAGGGGTGCAGCAGTGAGGG + Intronic
1071762499 10:88624457-88624479 GGCCAAGGTCATAGCAGTGAAGG + Intergenic
1073490418 10:103849575-103849597 GGTCAGGAGCCTAGCTGTGAAGG - Intronic
1074363156 10:112838686-112838708 GGGCAGGGGGGTGGCAGAGAAGG + Intergenic
1074646638 10:115460528-115460550 GGCCAGGGTAACAGCAGTGAAGG - Intronic
1076132327 10:128021998-128022020 GTCCAGGGGAGACGCAGTGATGG - Intronic
1076446829 10:130520094-130520116 GGCCAGGGCCACAGCCGTGAAGG - Intergenic
1076861506 10:133140240-133140262 GGGCAGGGGCGGGGCAGTGAAGG - Intergenic
1076861550 10:133140350-133140372 GGGCAGGGGCGGGGCAGTGAAGG - Intergenic
1077076136 11:703071-703093 GGCCAGGAGCGTGGCGCTGAGGG - Exonic
1077356868 11:2122752-2122774 GGCCAGGGGCCCAGCTGAGAAGG + Intergenic
1077679870 11:4228913-4228935 GGACAGTGGCATAGCAGTTAAGG + Intergenic
1077681615 11:4247000-4247022 GGACAGTGGCATAGCAGTTAAGG - Intergenic
1077684179 11:4275456-4275478 GGACAGTGGCATAGCAGTTAAGG + Intergenic
1077685864 11:4291309-4291331 GGACAGTGGCATAGCAGTTAAGG - Intergenic
1077689281 11:4325488-4325510 GGACAGTGGCATAGCAGTTAAGG + Intergenic
1077691013 11:4342469-4342491 GGACAGTGGCATAGCAGTTAAGG - Intergenic
1080995110 11:37589962-37589984 TGCCAGGGGTTTAGCAGAGAGGG + Intergenic
1081010876 11:37811550-37811572 AGCCAGGCGTGGAGCAGTGAGGG + Intergenic
1081308098 11:41537880-41537902 GACCAGGGTTGTTGCAGTGAAGG + Intergenic
1081604175 11:44517061-44517083 GGCCAGTGGAGTGGGAGTGATGG + Intergenic
1083305652 11:61760895-61760917 GGCCAGGGTGGTAGCAGTCAAGG - Intronic
1083673764 11:64314320-64314342 TGCCAGGGGCCCAGCAGGGAAGG - Exonic
1084120768 11:67067673-67067695 GGCCAGGGTGCTAGCAGTGGGGG + Intronic
1084708778 11:70831105-70831127 GGGCAGGCGGGTAGCAGAGAGGG + Intronic
1084795442 11:71501893-71501915 GGGCAGGGGCGTGGCACTGTGGG + Intronic
1085052307 11:73386210-73386232 CCCCAGGGGGGTAGCAGAGAAGG - Intronic
1086650214 11:89279355-89279377 GGGCAGGGCCTTAGCAATGAAGG - Intronic
1087985736 11:104677223-104677245 GACCAGGGGCGTTGCAGGGAGGG - Intergenic
1088499371 11:110467802-110467824 GGCCAGGTGCTTCCCAGTGATGG - Intergenic
1091403812 12:196672-196694 GGTCAGGGGAGTGGGAGTGAGGG + Intronic
1092179623 12:6436647-6436669 GGCAAGGGGAGAAACAGTGAGGG - Intergenic
1093170386 12:15853376-15853398 GACCAGGGTGGTAGCAGTGGAGG - Intronic
1097229894 12:57504146-57504168 GGCAAGGGGAGGAGCAGAGAAGG - Intronic
1097271823 12:57780267-57780289 GGCCAGGGGCAGGTCAGTGATGG - Exonic
1097446400 12:59678032-59678054 AGCCAGGTGTGGAGCAGTGAGGG + Intronic
1098086016 12:66844944-66844966 TGCCAGGGGCTGAGAAGTGATGG + Intergenic
1099713889 12:86265172-86265194 AGCCAGGCGTGGAGCAGTGAGGG - Intronic
1100689953 12:97029055-97029077 GGCCTGGGGGGTAGCAGTGAAGG + Intergenic
1101593101 12:106139827-106139849 GGCCAGGGACGTGGAAGAGATGG + Exonic
1101718902 12:107334304-107334326 AGCCAGGGTGGTAGCAGTGGAGG + Intronic
1104371596 12:128228505-128228527 GGCCAGTGTGGTAGGAGTGAGGG + Intergenic
1104847784 12:131855464-131855486 GGCCAGGAGGGTGGCAGGGAGGG - Intergenic
1105344496 13:19560736-19560758 TGCCAGGGGCCCAGCAGGGAAGG + Intergenic
1105535536 13:21260839-21260861 TGCCAGGGGCCCAGCAGGGAAGG - Intergenic
1105968293 13:25404540-25404562 ACCCAGGGGAGTGGCAGTGAGGG + Intronic
1106117582 13:26830594-26830616 TGCCAGGGGAGAAGCAGTGTTGG - Intergenic
1108542297 13:51455655-51455677 AGCCAGGTGCGGAGCAGCGAGGG + Intergenic
1109008649 13:56910470-56910492 AGCCAGGCGTGGAGCAGTGAGGG - Intergenic
1109469041 13:62780056-62780078 GGCCAGGGTGGTAGCATTAAAGG + Intergenic
1112097827 13:96153897-96153919 GGCCAGATGCTTAGCGGTGAGGG + Intronic
1112621189 13:101055870-101055892 GGCGAGGGGGGATGCAGTGAGGG + Intronic
1113873421 13:113579009-113579031 GGCCAGGGTTGTAGCAGAGGAGG + Intergenic
1118015131 14:61652813-61652835 GGCAAGGGGCAGGGCAGTGAGGG - Intronic
1118309756 14:64683572-64683594 GGCCAGGGGCTGGGCAGGGAGGG + Intergenic
1120405857 14:84092228-84092250 AGCCAGGGGTGTAGCAGCTAGGG - Intergenic
1121368782 14:93338037-93338059 AGCCAGGCGCAGAGCAGTGAGGG - Intronic
1121416102 14:93780164-93780186 AGTCAGGGGCGTAGCAGGGTAGG - Intronic
1121863433 14:97340394-97340416 GCCCAGTGGCATAGAAGTGAGGG + Intergenic
1122287059 14:100658433-100658455 GCCCTGGGGAGTGGCAGTGAGGG + Intergenic
1124861375 15:33445205-33445227 GGCTAGAGACTTAGCAGTGAGGG + Intronic
1124897482 15:33790349-33790371 GGCCAAGATGGTAGCAGTGAAGG + Intronic
1125195002 15:37035742-37035764 GGCAAGGGGTGGAGCAGTGGTGG - Intronic
1125903334 15:43369229-43369251 GGCCAGGGTTGTAGGGGTGAGGG + Intronic
1126334446 15:47570854-47570876 GGCCAGGGGTGTCTCAGTGATGG + Intronic
1126672174 15:51126416-51126438 TGCCAGGGGAGCAGCAGTTAGGG + Intergenic
1126772396 15:52071202-52071224 GGGCAGGGGCATATGAGTGATGG - Intergenic
1128342666 15:66833618-66833640 GCCCTGGGGCATAGTAGTGAAGG + Intergenic
1129174853 15:73832585-73832607 GGCCAGGGGGACGGCAGTGAGGG + Intergenic
1129183091 15:73889150-73889172 GGCCAGGGGCACTGGAGTGAGGG + Exonic
1129591207 15:76916543-76916565 AGCCAGGGGCGGAGCAGCAAGGG - Intergenic
1132846375 16:2002795-2002817 GGCCAGTGGCGGAGCAGCAAGGG + Intronic
1133052367 16:3124408-3124430 GGCTTGGGGCGTGGCGGTGAGGG - Intergenic
1134018579 16:10906469-10906491 GGCCAGGGGCGTGTCAGGGTGGG - Intronic
1134306449 16:13037455-13037477 GGGGAGGGGAGCAGCAGTGAGGG + Intronic
1134978451 16:18589006-18589028 AGCCATGGGCATAGCTGTGAAGG + Intergenic
1136061553 16:27730066-27730088 GCCCAGGGGCCCTGCAGTGAAGG + Intronic
1136365435 16:29807108-29807130 GGCCGGGGGCGCGGCAGCGACGG - Exonic
1140036815 16:71377559-71377581 GGCCAGTGGCGAGGCAGTGTGGG - Intronic
1140057948 16:71542248-71542270 GGGAAGGGGCTTGGCAGTGAAGG + Intronic
1141818161 16:86426895-86426917 GGACAGGGGAGTAGGGGTGAGGG - Intergenic
1142410767 16:89915477-89915499 GGGCTGGGGGGTAGCAGTGGAGG + Intronic
1144204933 17:12973554-12973576 GGCCAGGGTCCCAGCAGTGGTGG + Intronic
1144630513 17:16869804-16869826 GGCGAGGGGCAGAGCAGTCAGGG - Intergenic
1144650808 17:17005651-17005673 GGCGAGGGGCAGAGCAGTCAGGG + Intergenic
1145780988 17:27563090-27563112 GACCAGGGAGGTGGCAGTGATGG - Intronic
1147235294 17:39052738-39052760 GGCCAGAGGGCTAGCAATGAAGG + Intergenic
1147311187 17:39596937-39596959 GGCCCGCGGCGTGGCAGTGGCGG + Intergenic
1149256745 17:54836181-54836203 AGCCAGGTGTGGAGCAGTGAGGG + Intergenic
1150128627 17:62654145-62654167 GGCCTGGGGAGGGGCAGTGAAGG + Intronic
1150868725 17:68880751-68880773 AGCCAGGTGCATAGCGGTGATGG - Intronic
1153091484 18:1350492-1350514 GGCCAGAGGCTTACCAGTGATGG - Intergenic
1155053140 18:22165356-22165378 GGCCACGGGAGAAGCAGGGAGGG + Intergenic
1155095468 18:22550967-22550989 GGCCAGGGTAGAAGCAGTGGAGG + Intergenic
1157502804 18:48202942-48202964 GGCCAGGGGCGTAGGTGGGGAGG - Intronic
1157953324 18:52064787-52064809 GGCCAGGGAGGTGGCAGTGGAGG + Intergenic
1158453359 18:57586399-57586421 GGCGAGGGGCGTCGCGGAGAAGG - Intronic
1159938767 18:74389522-74389544 GGCCAGGGGAGGAGCACTGGGGG + Intergenic
1161637449 19:5397819-5397841 GAGAAGGGGAGTAGCAGTGAAGG + Intergenic
1162460110 19:10809863-10809885 GGCCATGGGTGGGGCAGTGACGG + Intronic
1162673671 19:12281698-12281720 GTCCATGGGAGTAGTAGTGATGG - Intronic
1165743494 19:38217264-38217286 GGCCAGGAGCGAAGGAGCGATGG + Intronic
1166903618 19:46087190-46087212 GGCAATGGCAGTAGCAGTGATGG + Intergenic
1168472941 19:56654481-56654503 GGCCAGGGTGGTGGTAGTGAAGG + Intronic
926614285 2:14980077-14980099 GGCAATTGGCTTAGCAGTGAAGG + Intergenic
927186812 2:20487999-20488021 GGCCAGGGGCCCAGCAGAGCTGG + Intergenic
928638008 2:33267239-33267261 AGCCAGGTGTGGAGCAGTGAGGG - Intronic
929258459 2:39839109-39839131 GGCCAGGGAGGAAGCAGAGAGGG - Intergenic
929589760 2:43137345-43137367 GGCCAGGGGCGTCCCACTGGAGG - Intergenic
929592706 2:43157617-43157639 GGCCTGGGGCGGAGCAGGGGTGG - Intergenic
932780255 2:74554751-74554773 GGCCATGGACGGAGCAGTGATGG + Exonic
932960426 2:76406714-76406736 GGCCAGGTGCAGAGCAGCGAGGG - Intergenic
933609405 2:84418046-84418068 TTCCAGGGGAGTAGCAGTGCTGG + Intergenic
935518646 2:104077623-104077645 AGTCAGGGGTGGAGCAGTGAGGG + Intergenic
937347224 2:121133523-121133545 GGCCCTGGGCGTAACATTGAAGG + Intergenic
938102586 2:128507194-128507216 TGCCAGGGCCTTAGCAGTGGAGG + Intergenic
940361871 2:152804813-152804835 GCCCAGGGGCTTAGGAGTGCAGG - Intergenic
940398549 2:153221674-153221696 AGCCAGGCGCAGAGCAGTGAAGG + Intergenic
942315506 2:174693320-174693342 AGCCAGGTGCGGAGCAGTGAGGG - Intergenic
943714376 2:191134263-191134285 GGCAATGGCAGTAGCAGTGATGG - Intronic
946861117 2:224001229-224001251 GCCCAGGGGCCTCGTAGTGATGG - Intronic
947728783 2:232416958-232416980 GGGCAGGGGCCTGGCAGGGAGGG + Intergenic
948468013 2:238161411-238161433 GGCCGGGGGAGAAGCTGTGAGGG + Intronic
948838469 2:240637428-240637450 GGCCAGGGTGGTAGAAGTCAGGG - Intergenic
948894695 2:240922650-240922672 GGCCAGGTGCGGGGCAGTCAGGG + Intronic
1169252452 20:4071081-4071103 GCCCAGGGGAGTTGCAGGGATGG + Intronic
1170356326 20:15496014-15496036 GGCCAGTGTCGTTGCAGTGGAGG + Intronic
1174186346 20:48708898-48708920 GGCCTGGGGAGGAGCAGTGTTGG - Intronic
1175561820 20:59937243-59937265 GGCCAGGGGCGTAGCAGTGAAGG + Exonic
1175934123 20:62507350-62507372 GGCCAGGGAGGTCCCAGTGATGG + Intergenic
1178919952 21:36732254-36732276 GGCCATGGGCGTGGCAGGGCTGG - Intronic
1179128191 21:38611174-38611196 GACCAGGGACGTTGCAGTGGAGG - Intronic
1180871747 22:19150446-19150468 GGCCGGGGGCGCTGCAGAGAGGG + Intergenic
1180906294 22:19414397-19414419 GGCCAGAGGCAAAGCAGAGAGGG + Intronic
1182246775 22:28964440-28964462 GGCCAGGGGCAGAGGGGTGAGGG + Intronic
1183096680 22:35556166-35556188 TGCCAGGGGCTCGGCAGTGAAGG + Intergenic
1183403556 22:37618768-37618790 GGCCAGGGGCGGGGCAGCCATGG + Intronic
1183901047 22:41006342-41006364 TGCCAAGGGGGTAGCAGTGGTGG - Intergenic
1183951171 22:41353891-41353913 GGCCAGGAGCCTGGCAGGGAAGG + Intronic
950111027 3:10418846-10418868 GGCCACCGGGGTAGCAGTGAGGG + Intronic
950538368 3:13594854-13594876 GGCCAGAGGGGTGGCAGGGAGGG + Intronic
954752415 3:52821147-52821169 AGCCAGGGCAGGAGCAGTGAGGG + Intronic
955486530 3:59439655-59439677 GGCCAGGAGCTTAGAAGTGCAGG + Intergenic
956989860 3:74751080-74751102 AGCCAGGTGTGGAGCAGTGAGGG + Intergenic
957418024 3:79930372-79930394 AGCCAGGCGTGGAGCAGTGAGGG - Intergenic
957608110 3:82430619-82430641 GGCCAGGATGGTAGCAGTGGAGG + Intergenic
958437883 3:94120426-94120448 TGCCAGGGGCTAAGAAGTGAAGG - Intronic
961450340 3:126999673-126999695 GGCCAGGGCTGTGGCGGTGATGG + Intronic
962763672 3:138542100-138542122 AGCCAGGTGCAGAGCAGTGAGGG + Intronic
963467632 3:145702642-145702664 TGCCAGGGAAGTAGCAGTGGAGG - Intergenic
965258308 3:166444985-166445007 AGCCAGGTGCGGAGTAGTGAGGG - Intergenic
968593365 4:1470785-1470807 GTCCAGGGGAGGAGCAGTGTGGG - Intergenic
968938229 4:3624608-3624630 GGGCAGGGGAGGAGCAGTGTGGG + Intergenic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
971271105 4:25146825-25146847 GGCCAGGGTGGTAGTTGTGAAGG - Intronic
972158700 4:36197651-36197673 AGCCAGGTGTGGAGCAGTGAGGG + Intronic
973853662 4:54987406-54987428 GGCCCTAGTCGTAGCAGTGATGG - Intergenic
977913027 4:102559510-102559532 AACCAAGGGAGTAGCAGTGAAGG + Intronic
979637752 4:122977299-122977321 AGCCAGGCGCAGAGCAGTGAAGG + Intronic
983296620 4:165874821-165874843 CGCCAGAGGCGTAGAAGGGAGGG - Intronic
983463613 4:168058009-168058031 AGCCAGGGCAGTAGAAGTGAAGG - Intergenic
983667229 4:170195761-170195783 GGCCAGGGCCTTAGAACTGATGG - Intergenic
985977284 5:3430235-3430257 GGCCATGGGCATAGCAGGGGTGG + Intergenic
986014846 5:3748809-3748831 GGTCAGGGGCATGGCAGTGAGGG - Intergenic
988202419 5:28084270-28084292 AGCCAGGCGCAGAGCAGTGAGGG - Intergenic
989104561 5:37849399-37849421 GGCCAGGGGAGGAGGAGTGGCGG - Intergenic
991481628 5:67087342-67087364 GGCCAGGGGAGTAGCAGAGGAGG - Intronic
993105508 5:83596069-83596091 GACCAGGGTGGTAGCAGTGGCGG - Intergenic
997209892 5:132071066-132071088 GGCCAAGGGCCTAGGAGGGAAGG - Intergenic
998480414 5:142458471-142458493 AGCCAGGTGCAGAGCAGTGAGGG + Intergenic
1001140137 5:169137509-169137531 GGCCAGGAGCTGAGCAGAGAAGG - Intronic
1003578037 6:7315327-7315349 GGCCAGGCGGGGGGCAGTGAGGG + Intronic
1004494249 6:16148714-16148736 GGCCTGGGTCATAGCAGTAAGGG + Intergenic
1006153422 6:32001422-32001444 GGCCTGGGGCGGGGCAGTGGAGG + Intronic
1006159730 6:32034159-32034181 GGCCTGGGGCGGGGCAGTGGAGG + Intronic
1006187611 6:32189939-32189961 GGGGAGGGGCGGAGCAGGGAGGG - Exonic
1006416927 6:33910111-33910133 GGCCTGGGGCGTAGCAGAAAAGG - Intergenic
1006838717 6:37014791-37014813 GGACTGGGGGGTAACAGTGAGGG - Intronic
1007764405 6:44152385-44152407 GGTCAGGGCGGTTGCAGTGATGG - Intronic
1010390114 6:75327285-75327307 GGCCAGGGGGATAGCAATGGAGG - Intronic
1010519827 6:76818713-76818735 AGCCAGGTGCGGAGCAGTGAGGG - Intergenic
1010921401 6:81686150-81686172 GGCCAGGGCAGTAACAATGAGGG - Intronic
1013372704 6:109483626-109483648 GGCCAGGGGCGGGGCGGTGTCGG + Intergenic
1013489259 6:110629383-110629405 GGGGAGGGGAGTGGCAGTGATGG - Intronic
1015333699 6:132010459-132010481 GACCAGGGTAGTAGCAGTGGAGG + Intergenic
1018433997 6:163744746-163744768 TGCCAGGGGCGCAGCTGGGATGG + Intergenic
1018593268 6:165451567-165451589 GGCCAGGGTTGTGACAGTGAGGG - Intronic
1019112025 6:169724280-169724302 GGCCAGCGGCGGAGCTGTGGGGG - Intronic
1019170145 6:170129245-170129267 GGGCAGGGGCGCAGGTGTGAAGG - Intergenic
1019430754 7:997828-997850 GGTCAGGGGCGGGGCAGGGAGGG + Intronic
1023506364 7:40903402-40903424 GGCCAGGGGAGAAGAAGAGAAGG + Intergenic
1023759712 7:43453260-43453282 GGCCAGGGTGGGAGCAGTGGAGG + Intronic
1024794932 7:53008877-53008899 AGCCAGGTGCGGAGTAGTGAGGG - Intergenic
1026058174 7:67003384-67003406 GACCAGGGGAGTAGCAGTGAAGG - Intronic
1026114216 7:67482789-67482811 GACCAGGGTGGTAGCAGTGTGGG - Intergenic
1026598290 7:71752551-71752573 TGCCCGGGGTGTAGCAGGGAGGG - Intergenic
1026719915 7:72821628-72821650 GACCAGGGGAGTAGCAGTGAAGG + Intronic
1028128824 7:87146889-87146911 GGCCAGGCGTGAAGCGGTGAGGG + Intergenic
1029805236 7:102989068-102989090 AGCCAAGGGAGTAGCAGGGATGG + Intronic
1030484366 7:110148195-110148217 AGCCAGGAGCAGAGCAGTGAGGG + Intergenic
1031069556 7:117146601-117146623 GGCCAGAGTGGTAGCAGAGAAGG + Intronic
1031248766 7:119351469-119351491 GGCCAGGTGTGGAGCAATGAGGG - Intergenic
1031921838 7:127608219-127608241 AGCCAGGAGTGGAGCAGTGAGGG + Intergenic
1031955668 7:127940009-127940031 GGCCAGTGGAGTAGTAGAGAAGG + Intronic
1031962003 7:127998621-127998643 GGCCAGGAGCCCAGAAGTGAAGG - Intronic
1032653543 7:133904279-133904301 GGCCAGGGAAGTAGCGGTGGAGG + Intronic
1036962621 8:13261622-13261644 GCCCAGGGTGGTGGCAGTGAGGG + Intronic
1040701847 8:50075228-50075250 GCCCAGGGGCTGAGCAGTGCAGG + Intronic
1041067284 8:54094226-54094248 GGGCTGGGGAGTAGCAGGGAGGG + Intronic
1041593946 8:59624178-59624200 GGGTGGGGGCCTAGCAGTGAGGG - Intergenic
1042017862 8:64336900-64336922 GGCCAGGGGCTGAGGTGTGAGGG - Intergenic
1042264158 8:66891744-66891766 AGCCAGGAGCGGAGCAGCGAGGG + Intronic
1043195674 8:77288506-77288528 AGCCAGGTGTGGAGCAGTGAGGG - Intergenic
1046711263 8:117514477-117514499 GTCCAAGGTCGCAGCAGTGATGG + Intergenic
1049024428 8:139979075-139979097 GGCCAGGTGCGGAGCCGTGAGGG + Intronic
1049432800 8:142573147-142573169 GGCCTGGGGAGCGGCAGTGAGGG - Intergenic
1050351174 9:4741808-4741830 GTCCAGGGGGGTAGAAGGGAGGG - Intronic
1051281290 9:15443805-15443827 GGCGAGGGGCGAAGGAGTGAGGG + Intronic
1051714845 9:19971709-19971731 GACCAGGAGCTGAGCAGTGAAGG + Intergenic
1052552421 9:29968973-29968995 AGCCAGGGATGGAGCAGTGAGGG + Intergenic
1053054816 9:34988114-34988136 GGCCAGGAGGGGAGCAGAGATGG - Intergenic
1054452966 9:65413151-65413173 GGGCAGGGGAGGAGCAGTGTGGG - Intergenic
1055563177 9:77542601-77542623 GGCAATGGCAGTAGCAGTGATGG + Intronic
1058143202 9:101380325-101380347 GGTCTGGGGAGTAACAGTGAGGG + Intronic
1059189516 9:112311163-112311185 GGCCAGGGCAGTTGCAGTTATGG + Intronic
1060184125 9:121553487-121553509 GGCCAGGGCTGAAGTAGTGATGG - Intergenic
1060374697 9:123107691-123107713 GGGCAGGGGCTGAGTAGTGAGGG + Intergenic
1060407374 9:123379541-123379563 GGCCAGGCGCAGAGCAGTTAGGG - Intronic
1061212835 9:129203485-129203507 GGCCAGGGCAGGAGCAGGGAAGG + Intergenic
1062028736 9:134352478-134352500 GGGCAGGGGCGAGGCAGGGAGGG - Intronic
1062443547 9:136584033-136584055 GGCCAGGGACGCTGGAGTGAGGG + Intergenic
1186196881 X:7117810-7117832 GCCCAGGGGCCTAGAAGAGAAGG + Intronic
1187491995 X:19760834-19760856 GGCCAGGGGCTAAGAAGGGATGG + Intronic
1188767915 X:34119483-34119505 GGCAATAGGCTTAGCAGTGAAGG - Intergenic
1190141581 X:47850588-47850610 GACCAGGGGCGTTGCAGGGAGGG + Intronic
1192605144 X:72508707-72508729 GGCAAGGGGCTTAGAAGAGATGG - Intronic
1195880186 X:109585639-109585661 AGCCAGGCACGGAGCAGTGAGGG + Intergenic
1198090393 X:133322979-133323001 GGGGAGGGGAGTGGCAGTGAAGG + Intronic
1198146707 X:133864530-133864552 GGCATGGGGCTGAGCAGTGATGG - Intronic