ID: 1175562279

View in Genome Browser
Species Human (GRCh38)
Location 20:59940340-59940362
Sequence CGGCGTCACGAGGGGCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 197}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175562279_1175562300 26 Left 1175562279 20:59940340-59940362 CCGCCCCGCCCCTCGTGACGCCG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1175562300 20:59940389-59940411 AGCTCAGCCAGGGAGCTCAGCGG 0: 1
1: 0
2: 3
3: 35
4: 341
1175562279_1175562297 16 Left 1175562279 20:59940340-59940362 CCGCCCCGCCCCTCGTGACGCCG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1175562297 20:59940379-59940401 CGCCGGCCTCAGCTCAGCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 160
1175562279_1175562290 -1 Left 1175562279 20:59940340-59940362 CCGCCCCGCCCCTCGTGACGCCG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1175562290 20:59940362-59940384 GCCTGCAGGCGGGCCCCCGCCGG 0: 1
1: 0
2: 0
3: 17
4: 192
1175562279_1175562296 15 Left 1175562279 20:59940340-59940362 CCGCCCCGCCCCTCGTGACGCCG 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1175562296 20:59940378-59940400 CCGCCGGCCTCAGCTCAGCCAGG 0: 1
1: 1
2: 2
3: 19
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175562279 Original CRISPR CGGCGTCACGAGGGGCGGGG CGG (reversed) Intronic
900631673 1:3639677-3639699 CGGGGACACAAGGTGCGGGGTGG + Intronic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
903190274 1:21652166-21652188 CGGCGGCTCGAGGGGGCGGGAGG - Intronic
903199163 1:21719190-21719212 CGGAGGGACGGGGGGCGGGGGGG + Intronic
903466391 1:23554971-23554993 GGGCGCCGGGAGGGGCGGGGCGG + Intergenic
904039541 1:27575902-27575924 CGGGGTCACGTGGCGGGGGGAGG + Intronic
904772134 1:32886432-32886454 GGGCGGCAGGAGGGGCGGGCGGG - Exonic
906325583 1:44843371-44843393 CGGCGCCGCAGGGGGCGGGGCGG + Intergenic
906627040 1:47333882-47333904 CGGCGCGGCGCGGGGCGGGGCGG - Exonic
907069313 1:51519376-51519398 CGGGGCCAGGCGGGGCGGGGCGG - Intergenic
908501275 1:64745445-64745467 ACGCGTCCCGAGGGGCGGCGGGG + Intronic
915333846 1:155129394-155129416 CGGCGTCAGGGAAGGCGGGGAGG - Intronic
919743096 1:200992271-200992293 CGGCGACAGGAGGTGAGGGGTGG - Exonic
919949442 1:202348958-202348980 CGGAGCGACGAGGCGCGGGGCGG + Exonic
923181981 1:231528621-231528643 CTGCGTCCGGAGGGGAGGGGAGG - Intergenic
924801620 1:247332329-247332351 CAGCGGCAGGAGGGGCTGGGCGG - Intergenic
1063395672 10:5685068-5685090 CGGTGTCGCGAGGGCCCGGGAGG + Exonic
1066453081 10:35549106-35549128 TGGCATGATGAGGGGCGGGGGGG - Intronic
1066956350 10:42177326-42177348 CCGCGGCACGTGGGGGGGGGTGG - Intergenic
1070609970 10:77926535-77926557 AGGCGTCCGGCGGGGCGGGGCGG - Intergenic
1074137975 10:110644309-110644331 AGGAGACGCGAGGGGCGGGGAGG - Intergenic
1075048580 10:119165500-119165522 CGGCGCGACTAGGGGCAGGGAGG - Intronic
1075999745 10:126905385-126905407 CGGCGTCATGTGGGACGGGGCGG - Intergenic
1076749890 10:132537420-132537442 CCGCGGCGCGGGGGGCGGGGCGG + Intergenic
1077079978 11:720928-720950 CGGGGTCGCAGGGGGCGGGGAGG + Intronic
1077093525 11:789963-789985 CGGCGTCCTGCGGGGCGAGGAGG - Intronic
1080012354 11:27472081-27472103 CGGGGACGCGAGGGGGGGGGAGG - Intronic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1083619343 11:64041342-64041364 AGGCGTCACGGGGGGTGGAGGGG - Intronic
1083667654 11:64284596-64284618 CGCCGTCACCACGGGCGGGGCGG - Exonic
1084183158 11:67456486-67456508 GGGGGTCACGAGGGGCTGGCAGG + Intronic
1084304375 11:68272001-68272023 TGACGTCACGGAGGGCGGGGCGG + Intronic
1084499211 11:69525021-69525043 CGGTGTGATGAGGGGCTGGGGGG + Intergenic
1085031343 11:73272676-73272698 CGGGGTCAGTGGGGGCGGGGAGG + Intronic
1087076133 11:94128793-94128815 CGCGGTGACGCGGGGCGGGGTGG - Intergenic
1088604087 11:111512426-111512448 CCGCGGGCCGAGGGGCGGGGCGG - Intergenic
1089191980 11:116660104-116660126 TGGCCTGAGGAGGGGCGGGGAGG - Intergenic
1090305056 11:125684135-125684157 TGGCGGCAGGTGGGGCGGGGAGG + Intergenic
1090385539 11:126355865-126355887 CGGGGGCCCGCGGGGCGGGGCGG + Intronic
1094041113 12:26122623-26122645 CGGCGGCCCGGGGGGCGGCGCGG - Exonic
1096178824 12:49539608-49539630 CAGCCTCAAGAGGGGCGGGTAGG - Intronic
1097189631 12:57213193-57213215 TGGCGTCCCCAGGGGAGGGGAGG - Exonic
1097246901 12:57611826-57611848 GGGAATCACGGGGGGCGGGGCGG - Intronic
1098320624 12:69239856-69239878 CGGTAGAACGAGGGGCGGGGGGG - Intronic
1102822180 12:115917266-115917288 CGGCTTCGCGCGGGGCTGGGCGG + Intergenic
1102934085 12:116882230-116882252 CGGCGAGAGGAGGGGCGCGGGGG + Intergenic
1103294847 12:119877280-119877302 CGGCGGCGGGAGGCGCGGGGCGG - Exonic
1103969401 12:124660657-124660679 CAGTGGCAGGAGGGGCGGGGAGG - Intergenic
1104983407 12:132583663-132583685 CGGCGGCCCGGGGGGCGTGGGGG - Exonic
1105799275 13:23889412-23889434 GGCCGTCACGTGGGGCGGCGTGG - Exonic
1112216268 13:97434141-97434163 TGGAGGCGCGAGGGGCGGGGCGG + Intergenic
1112294750 13:98176984-98177006 CGGCGACAGGAGGGGCGAGGAGG - Exonic
1113654100 13:112057406-112057428 GGGAGCCGCGAGGGGCGGGGAGG - Intergenic
1113940680 13:114017191-114017213 CAGCCTCACGAGGCGTGGGGAGG - Intronic
1117029060 14:51651298-51651320 CGGCGTCTCGAGTGGCGGGCGGG + Intronic
1120503249 14:85323298-85323320 GGGTGTCTCGAGGGGTGGGGGGG - Intergenic
1121168893 14:91836543-91836565 GCCCGTCCCGAGGGGCGGGGCGG - Intronic
1122030498 14:98908264-98908286 CGGAGGCAGGTGGGGCGGGGTGG - Intergenic
1123028878 14:105441261-105441283 AGGAGGCAAGAGGGGCGGGGGGG - Intronic
1124999380 15:34754775-34754797 CGCCGGGACGAGGGGCGGGGCGG + Exonic
1129240075 15:74245734-74245756 CTGCGGCACGTGGGGCGGGAGGG + Intronic
1129287960 15:74541134-74541156 CGGGGCCACAGGGGGCGGGGCGG - Intergenic
1132143588 15:99413756-99413778 TGGCGGCAGGAGGGGTGGGGGGG + Intergenic
1132320200 15:100919624-100919646 CCGCGGCCCGAGGGGCGCGGAGG + Intronic
1132498781 16:275747-275769 CGGGGGCGCGCGGGGCGGGGCGG - Intronic
1132512989 16:353188-353210 CGTCTTCCCGAGGGGCGGTGCGG + Intergenic
1133115588 16:3576374-3576396 CGAGGTCATGAGGGGCAGGGAGG - Intronic
1133156564 16:3880467-3880489 CGGCGGAACGGGGGGTGGGGGGG - Exonic
1136705878 16:32187933-32187955 GGGCGGCACAAGGGGTGGGGGGG - Intergenic
1139631892 16:68236206-68236228 TGGCGCCCCGCGGGGCGGGGCGG + Exonic
1140847243 16:78902420-78902442 CAGCGCCACGCGGGGCGGGCGGG + Intronic
1141683139 16:85555589-85555611 CTGGGTGAGGAGGGGCGGGGTGG - Intergenic
1203064193 16_KI270728v1_random:1001788-1001810 GGGCGGCACAAGGGGTGGGGGGG + Intergenic
1142509419 17:385027-385049 CGGTGTCGGGCGGGGCGGGGCGG + Intronic
1142763482 17:2054045-2054067 GGGGGTCAGGAGGTGCGGGGCGG + Intergenic
1143390485 17:6556613-6556635 CGGCGGCGCGGGGGGTGGGGTGG - Intergenic
1145370818 17:22304817-22304839 CGGCGACACGACGGGCTGCGGGG - Intergenic
1145884160 17:28371358-28371380 CGATGTCACGTGGGGCGGGGAGG + Intronic
1146763275 17:35496545-35496567 CGAGGTCATGAGGGGAGGGGAGG - Intronic
1147752563 17:42745081-42745103 CGCCGACAGGAGGCGCGGGGCGG - Intergenic
1147951644 17:44111018-44111040 TGGCGGCAGGAGGGGCAGGGAGG + Intronic
1148768872 17:50055823-50055845 CGGAGAAGCGAGGGGCGGGGAGG + Intergenic
1149626354 17:58083349-58083371 CGGCGGCGCGCGCGGCGGGGGGG + Intergenic
1149772486 17:59332236-59332258 CGGCGTCACGAGAGGACGGAGGG - Intronic
1151827467 17:76531206-76531228 CGGCCACACGTGGGGCGGAGGGG - Intronic
1153515027 18:5894933-5894955 CGGGGACCCGAGGGGCGGGGAGG + Intronic
1154241603 18:12658119-12658141 CGGCGCGAGGCGGGGCGGGGCGG - Exonic
1160690841 19:460310-460332 CGGCGTCACGTGGGGAGGGGCGG - Intronic
1160740001 19:681187-681209 GGGGCTCACGGGGGGCGGGGGGG + Intronic
1160826338 19:1082193-1082215 CAGGGACAGGAGGGGCGGGGTGG + Intronic
1161502326 19:4623186-4623208 CGGGGACACTGGGGGCGGGGTGG + Intergenic
1161827333 19:6577082-6577104 CGGGGTCACAAGGTGCGGTGGGG - Intergenic
1162381714 19:10335319-10335341 GGGGGCCACGAGGCGCGGGGGGG + Exonic
1162439741 19:10685796-10685818 CGGCTTCAGGCGGGGCGAGGTGG + Intronic
1162687689 19:12401030-12401052 CGGCGTCCCGAGGCGGGGGAGGG - Intronic
1162692012 19:12440874-12440896 CGGCGTCCCGAGGCGGGGGAGGG - Intronic
1162805295 19:13135180-13135202 CGGCTGCACGAGGGGCAGGGAGG - Exonic
1162805394 19:13135680-13135702 CCGCGACACGAGGGGCAGCGGGG - Exonic
1162911588 19:13850652-13850674 CGGCGTCCGGAGGGGCCCGGCGG + Intergenic
1164643848 19:29844492-29844514 CGGGGAGACGCGGGGCGGGGCGG - Intergenic
1164989541 19:32674572-32674594 CGGCCTCTCGCAGGGCGGGGGGG - Intronic
1165668660 19:37655792-37655814 AGGCGTCGCTGGGGGCGGGGCGG - Intronic
1167018881 19:46860278-46860300 CGACGTAACGTGGGGCGGTGGGG - Intergenic
1167377658 19:49120224-49120246 CGGCGGCAGGAGGTGGGGGGAGG - Intronic
1168322154 19:55517139-55517161 CGGCTCCTCGAGGGGCGGGGCGG + Intronic
926292005 2:11538913-11538935 AGGGGACACGAGGGGAGGGGAGG - Intronic
926292014 2:11538933-11538955 AGGGGACACGAGGGGAGGGGAGG - Intronic
927514419 2:23663429-23663451 CGCCGTCACGTGTGCCGGGGAGG + Intronic
927855096 2:26522915-26522937 TGGCCCCACGAGGGGCTGGGCGG + Intronic
929701845 2:44169106-44169128 CGGCGGCGTGAGGGGCCGGGCGG + Exonic
933686690 2:85147401-85147423 CAGCATCACGTGGGGAGGGGTGG - Intronic
934304580 2:91810366-91810388 CCGCGGCACGGTGGGCGGGGGGG - Intergenic
934328677 2:92042384-92042406 CCGCGGCACGGTGGGCGGGGGGG + Intergenic
936608429 2:113979376-113979398 CGGCATCACGGGGGCGGGGGCGG - Intergenic
937312853 2:120912685-120912707 CGGGGTCATGAGGGGCAGTGCGG - Intronic
937418588 2:121736965-121736987 AGGCGTGGCGAGGGGCGGGGAGG + Intergenic
938408742 2:131046746-131046768 CGGTGTCTTGAGGGGCTGGGAGG - Exonic
938983169 2:136546144-136546166 CAGCATCACAAGGAGCGGGGAGG - Intergenic
946386739 2:219388162-219388184 AAGCTTGACGAGGGGCGGGGCGG - Intronic
946386788 2:219388311-219388333 AGGCCTGACGAAGGGCGGGGCGG - Intronic
946386818 2:219388403-219388425 AAGCGTGACGAGCGGCGGGGCGG - Intronic
946386825 2:219388432-219388454 CAGCCTAGCGAGGGGCGGGGCGG - Intronic
1168756771 20:324177-324199 CCGCGGCGCGGGGGGCGGGGTGG - Intergenic
1168855029 20:1002231-1002253 CGGCGGCACGGCGGGCGCGGGGG + Exonic
1168965088 20:1894251-1894273 CGGGGGCGCGGGGGGCGGGGGGG - Exonic
1171452824 20:25248003-25248025 CGGGGCCTCGGGGGGCGGGGCGG - Intergenic
1172274990 20:33674475-33674497 CGGCGTCCGCGGGGGCGGGGCGG - Intergenic
1172939800 20:38646328-38646350 CGCCGTCACGGGGAGCGAGGAGG + Intronic
1174317344 20:49713335-49713357 TGGCGTTAGGAGGGGCGGGGTGG + Intronic
1175198158 20:57260392-57260414 TGACGTCACCAGGAGCGGGGAGG - Intronic
1175210443 20:57350865-57350887 CGGGGGGACGGGGGGCGGGGGGG + Intergenic
1175429516 20:58891650-58891672 CGGCCTCACGCGGGCCGGGAGGG - Intronic
1175562279 20:59940340-59940362 CGGCGTCACGAGGGGCGGGGCGG - Intronic
1176218148 20:63957834-63957856 CAGCCTCATGAGGGGAGGGGAGG - Exonic
1176232129 20:64038064-64038086 CGCCGTGAAGTGGGGCGGGGCGG + Intronic
1176422567 21:6527870-6527892 CGGGGTCGGCAGGGGCGGGGTGG + Intergenic
1178673823 21:34614652-34614674 CGGCCGCGCGCGGGGCGGGGAGG - Intronic
1178948459 21:36966805-36966827 CTGCGGCGGGAGGGGCGGGGGGG + Intronic
1179698060 21:43136186-43136208 CGGGGTCGGCAGGGGCGGGGTGG + Intergenic
1181007501 22:20021013-20021035 CCGCGCAGCGAGGGGCGGGGCGG - Intronic
1181164187 22:20974630-20974652 TGGGGTCATGAGGGGCAGGGTGG + Intronic
1181902812 22:26169766-26169788 AAGCGCCCCGAGGGGCGGGGCGG + Intronic
1183969169 22:41463301-41463323 CTGAGTCACGACGGGCGTGGTGG + Intronic
1184472138 22:44702145-44702167 CGGCGCCCCGGGGGGCGGGGCGG - Intronic
1184545251 22:45163445-45163467 CGGCGCCAGGAGGGGCCGTGTGG - Intergenic
1185271073 22:49929529-49929551 CGGCGCCGCGTGGGGAGGGGCGG - Intergenic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
1185331918 22:50255771-50255793 GGGCGGCACCAGGGGCGGGTGGG - Intronic
953549890 3:43894030-43894052 CGGAGTCCAGGGGGGCGGGGGGG + Intergenic
954004217 3:47578863-47578885 CGGCGGCGCGGGAGGCGGGGAGG - Exonic
954615640 3:51967603-51967625 CCGCGGCGCGCGGGGCGGGGCGG - Intronic
960096749 3:113696661-113696683 CGGCCGCGGGAGGGGCGGGGAGG - Intergenic
961013395 3:123449803-123449825 GGGCGGCGCGGGGGGCGGGGAGG - Intergenic
967093782 3:186159839-186159861 TGAGGTCACAAGGGGCGGGGGGG + Intronic
968213480 3:196868336-196868358 CGGCTTCAGGAGGAGCTGGGGGG - Intronic
968585644 4:1414831-1414853 CGGCGGTGCGAGGGGCGTGGGGG - Intergenic
969346772 4:6575152-6575174 CGGGTCCGCGAGGGGCGGGGCGG - Intergenic
969716827 4:8871867-8871889 CGGCCTCACTGGGGGCGGGGAGG + Intergenic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
977719018 4:100217149-100217171 TGGCGGCACTGGGGGCGGGGAGG - Intergenic
984155886 4:176195623-176195645 CGCGGTCTCGTGGGGCGGGGCGG + Exonic
985832077 5:2241128-2241150 TGGGGTGACGAGGTGCGGGGCGG - Intergenic
986330527 5:6713673-6713695 CCGCTTCACGCGGCGCGGGGCGG - Intergenic
987050212 5:14142908-14142930 CGGGGTGACGCGGGCCGGGGCGG - Intergenic
987070788 5:14335263-14335285 GGGCGTCATGTGGGGAGGGGTGG - Intronic
990165486 5:52989267-52989289 CGGAATCAGGAGGGGCGGGCTGG + Intergenic
996405438 5:123098828-123098850 CGGGGACAGGTGGGGCGGGGTGG - Intronic
999325579 5:150641432-150641454 CAGGGTCAGGTGGGGCGGGGTGG - Intronic
1001529947 5:172454590-172454612 CGGCGGCGCGGGGGGCGGTGCGG - Intergenic
1001599343 5:172918935-172918957 CAGCGTGATGAGGGGCGTGGTGG - Intronic
1002061604 5:176629016-176629038 AGGCGCCACAAGGGGAGGGGTGG + Intronic
1002211138 5:177600085-177600107 CGGCGGACCGGGGGGCGGGGCGG + Exonic
1006606218 6:35259606-35259628 CGGCGAAGCGGGGGGCGGGGTGG + Intronic
1013048664 6:106511723-106511745 CGGCGTCAGGGGGGGCTGCGGGG - Intergenic
1015843453 6:137495756-137495778 CAGCAGCACGAGGGGCGGGAAGG + Intergenic
1017470459 6:154733482-154733504 CTGCGGCCCGAGCGGCGGGGAGG + Exonic
1018876778 6:167827576-167827598 CGGCGGCGCGGGGGGCGCGGCGG + Intronic
1019402940 7:866716-866738 CGGTGGGACGGGGGGCGGGGGGG - Intronic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1020023656 7:4883696-4883718 CGGCGGCGCAACGGGCGGGGCGG + Exonic
1026850360 7:73719722-73719744 CGGGGTCCCGGGGGCCGGGGCGG - Intergenic
1029461102 7:100694262-100694284 CCGCGTCACGTGGTGCGAGGCGG - Intergenic
1030348312 7:108456639-108456661 CGGCGCCTCGAGGGACTGGGTGG + Intronic
1033477184 7:141702172-141702194 CGCGGGCGCGAGGGGCGGGGCGG + Intergenic
1036398227 8:8386484-8386506 CGGCGTCACCGGAGGCGGAGGGG - Exonic
1039542317 8:38382273-38382295 CGGCGCCCCGAGAGTCGGGGTGG - Intergenic
1043395492 8:79831820-79831842 CGGGGTGACGAGGGGCGTGCTGG + Intergenic
1044630104 8:94270378-94270400 AGGCATGATGAGGGGCGGGGAGG - Intergenic
1044973703 8:97644096-97644118 GGGCGTCACGTGGGGGCGGGCGG - Intergenic
1049221701 8:141431543-141431565 CAGCGTCAGGCGGGGCGGGCTGG + Exonic
1052829381 9:33202618-33202640 CGGCAGCACCAGAGGCGGGGAGG - Intergenic
1052991894 9:34523318-34523340 CGCCGGCACGAGAGGCGGGCTGG - Intergenic
1054407092 9:64772918-64772940 CCGCGGCACGAGGGGGGGTGGGG + Intergenic
1055611773 9:78031573-78031595 CGGCGGCTCGGGGGGCGAGGCGG - Intergenic
1057781914 9:98056972-98056994 GGGCGCCGGGAGGGGCGGGGCGG + Intronic
1058005156 9:99906622-99906644 GGGCATCACGAGGGGTGGGCAGG - Exonic
1059208309 9:112486926-112486948 CGGCGGACCGAGGAGCGGGGCGG - Intronic
1060230071 9:121819590-121819612 AGGCGTCAGGAGGAGCGGGAAGG + Intergenic
1060799370 9:126533980-126534002 GGGCGTCCCGAGGGGCAGGCTGG + Intergenic
1061542057 9:131282896-131282918 CGGCGTCGGGGTGGGCGGGGCGG - Intergenic
1062013952 9:134281971-134281993 TGGCCTCACGAGGGATGGGGTGG - Intergenic
1062284033 9:135765230-135765252 TGGCGTCTCTAGGGGCCGGGAGG - Intronic
1062583889 9:137240472-137240494 CCGCGCCCCGAGGGCCGGGGCGG - Intergenic
1062623919 9:137434539-137434561 GGGCCTCAGGAGGGGCGGAGAGG - Exonic
1187332649 X:18354723-18354745 CGGCCGCGCGGGGGGCGGGGCGG - Exonic
1189322561 X:40095742-40095764 CGGCGTCTGGAGGGTGGGGGTGG - Intronic
1189763234 X:44343694-44343716 CGGCGTCACGGAGGGAGGAGGGG + Intergenic
1190007993 X:46758640-46758662 CGGCGCCAGGAGGAGCGCGGCGG + Intronic
1198268549 X:135032822-135032844 CGGCGGCTCGAGGGGGAGGGAGG - Exonic
1198270423 X:135051648-135051670 CGGCGGCTCGAGGGGGAGGGAGG + Exonic
1200084885 X:153599187-153599209 CGGGGCGGCGAGGGGCGGGGCGG - Intronic
1200084895 X:153599207-153599229 CGGGGCGGCGAGGGGCGGGGCGG - Intronic
1200084905 X:153599227-153599249 CGGGGCGGCGAGGGGCGGGGCGG - Intronic