ID: 1175563522

View in Genome Browser
Species Human (GRCh38)
Location 20:59953859-59953881
Sequence CATGGCAGGCAGAAGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175563522_1175563530 4 Left 1175563522 20:59953859-59953881 CCTTCCAGCTTCTGCCTGCCATG No data
Right 1175563530 20:59953886-59953908 CCCTCCAGGGCCTCCACTGTGGG No data
1175563522_1175563526 -9 Left 1175563522 20:59953859-59953881 CCTTCCAGCTTCTGCCTGCCATG No data
Right 1175563526 20:59953873-59953895 CCTGCCATGCTCACCCTCCAGGG No data
1175563522_1175563524 -10 Left 1175563522 20:59953859-59953881 CCTTCCAGCTTCTGCCTGCCATG No data
Right 1175563524 20:59953872-59953894 GCCTGCCATGCTCACCCTCCAGG No data
1175563522_1175563528 3 Left 1175563522 20:59953859-59953881 CCTTCCAGCTTCTGCCTGCCATG No data
Right 1175563528 20:59953885-59953907 ACCCTCCAGGGCCTCCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175563522 Original CRISPR CATGGCAGGCAGAAGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr