ID: 1175567111

View in Genome Browser
Species Human (GRCh38)
Location 20:59989081-59989103
Sequence TTCATTGTCAATAAAGAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 267}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175567101_1175567111 2 Left 1175567101 20:59989056-59989078 CCCACCAGCCTTTCACCCCCAGA 0: 1
1: 0
2: 4
3: 30
4: 252
Right 1175567111 20:59989081-59989103 TTCATTGTCAATAAAGAGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 267
1175567103_1175567111 -2 Left 1175567103 20:59989060-59989082 CCAGCCTTTCACCCCCAGAGCTT 0: 1
1: 0
2: 2
3: 33
4: 273
Right 1175567111 20:59989081-59989103 TTCATTGTCAATAAAGAGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 267
1175567100_1175567111 9 Left 1175567100 20:59989049-59989071 CCAACGACCCACCAGCCTTTCAC 0: 1
1: 0
2: 1
3: 20
4: 168
Right 1175567111 20:59989081-59989103 TTCATTGTCAATAAAGAGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 267
1175567104_1175567111 -6 Left 1175567104 20:59989064-59989086 CCTTTCACCCCCAGAGCTTCATT 0: 1
1: 0
2: 1
3: 25
4: 247
Right 1175567111 20:59989081-59989103 TTCATTGTCAATAAAGAGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 267
1175567102_1175567111 1 Left 1175567102 20:59989057-59989079 CCACCAGCCTTTCACCCCCAGAG 0: 1
1: 0
2: 2
3: 43
4: 667
Right 1175567111 20:59989081-59989103 TTCATTGTCAATAAAGAGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175567111 Original CRISPR TTCATTGTCAATAAAGAGGA GGG Exonic
901874263 1:12158064-12158086 TTTATTGACAAAAAAGAGGAAGG + Intergenic
902074471 1:13772430-13772452 TTCATTAACAATTCAGAGGATGG - Intronic
902212769 1:14915595-14915617 TTCATTCTTCATAAAGAGGGGGG - Intronic
903937382 1:26905841-26905863 TTCTTTGTCTATAAAATGGATGG + Intronic
905738537 1:40349265-40349287 TTCATAGTCAATAATAACGAAGG + Intronic
906444566 1:45884190-45884212 TACTTTATCAAAAAAGAGGAGGG - Intronic
906915063 1:50000322-50000344 TTCAGTGTCACTAATGAGCAAGG + Intronic
907188182 1:52627613-52627635 TTACTTAGCAATAAAGAGGAAGG + Intergenic
907635646 1:56132220-56132242 TTCACTGGCAAAATAGAGGATGG - Intergenic
908374443 1:63520961-63520983 TTCAGTGACAATAGAGCGGATGG - Intronic
909105004 1:71396349-71396371 TTTATTGTCAAATAAGTGGATGG + Exonic
910941217 1:92536210-92536232 TGCATTATCAATAAAGAGATCGG + Intronic
911755443 1:101548790-101548812 TTCATTATCACTAATGATGATGG + Intergenic
911793788 1:102051976-102051998 TTATTTATCAATAAAGAGGTGGG + Intergenic
912173014 1:107123764-107123786 TGCATTTAGAATAAAGAGGATGG + Intergenic
916726099 1:167525674-167525696 GTCATTGTCATTACAGAGAAGGG + Intergenic
917233153 1:172859642-172859664 TTCTTTGTCTATAAAGGGGCAGG - Intergenic
917457665 1:175199392-175199414 TGCATTGACAAGAAAGAGGTGGG - Intergenic
917670827 1:177271811-177271833 TTCATTTTCAAGAATGAGTAGGG - Intronic
918057800 1:181037429-181037451 TTCAATGCCAATTAAGAAGAGGG - Intronic
919235867 1:194841797-194841819 TCCATTTTCAGTAAGGAGGATGG - Intergenic
922780338 1:228247319-228247341 TTCCATGTCCATAAAAAGGAGGG - Intronic
1062853850 10:769375-769397 TTCATTGTAAGAAAAAAGGACGG + Intergenic
1063459778 10:6207627-6207649 TTCTTTGTCTATAAAAAGCAGGG - Intronic
1063775345 10:9257021-9257043 TTCATCCTCAATAATGGGGAGGG + Intergenic
1064044913 10:12004573-12004595 TTCATTGTCTTTAAACAAGATGG + Exonic
1065035066 10:21629609-21629631 ATCATTGTCAATAGTGGGGAAGG + Intronic
1065248022 10:23778783-23778805 TTCATTGGCAATAAAGGGATTGG + Intronic
1066065268 10:31757128-31757150 TTTTTTGGCAAAAAAGAGGATGG - Intergenic
1066376923 10:34865857-34865879 CTCATTGTAAATAAAGAATATGG - Intergenic
1069771838 10:70905363-70905385 TTGATTCTCAAGAAAGATGAGGG - Intergenic
1070405231 10:76088475-76088497 TTGGTTGCCAATAAACAGGAAGG + Intronic
1070453368 10:76584505-76584527 TTCAAAGTAAATAAAGAGGCTGG + Intergenic
1075583642 10:123641969-123641991 TTACTTGGCAATAAAAAGGAAGG + Intergenic
1075901195 10:126043849-126043871 TTCATTGTGAAATAAGAGAATGG + Intronic
1076212116 10:128657314-128657336 TTCATTGGGAAGAAAAAGGAGGG - Intergenic
1076414923 10:130279036-130279058 TTCATGGTTAATGAAGAAGATGG + Intergenic
1077435183 11:2535532-2535554 TTCAGTGTCACTAAAGGGGAAGG - Intronic
1078453117 11:11454971-11454993 TTCAATGTCAACAATGAGGAAGG - Intronic
1079613771 11:22465726-22465748 TTATTTGTCAATTAAAAGGAAGG - Intergenic
1080168694 11:29272249-29272271 TTAATTTTCAAGGAAGAGGATGG - Intergenic
1080372228 11:31664308-31664330 CCCATTGTCATTAATGAGGATGG + Intronic
1080658786 11:34279105-34279127 TTCATTTTGAAGTAAGAGGATGG - Intronic
1085034110 11:73289838-73289860 TTCTTCGTCTATAAAGGGGAGGG + Intronic
1086617605 11:88841077-88841099 TGTATTGTCAAAAAACAGGAGGG + Intronic
1087008760 11:93493988-93494010 TTCCTCATCAATAAAGATGAGGG - Intronic
1087607907 11:100399450-100399472 TGCTAAGTCAATAAAGAGGATGG + Intergenic
1087849411 11:103010904-103010926 TTCAGTATCAATGAAGAGAATGG - Intergenic
1088138274 11:106584134-106584156 TTCATTTGCAATAACGTGGATGG - Intergenic
1088373007 11:109111915-109111937 TTCACTGACAATGAAGAGGGTGG - Intergenic
1088870722 11:113888238-113888260 TTCATTGGCAAGACAGAGAACGG + Intergenic
1090232959 11:125122811-125122833 TTCATTGTGCAGAAAGAGAAAGG + Intergenic
1090499686 11:127249251-127249273 TTCATTGTCATAGAAGAAGAAGG - Intergenic
1090738978 11:129639679-129639701 GTCATTTTCTATAAAGAGGTTGG - Intergenic
1090921341 11:131208578-131208600 TGCATTGTCCCTGAAGAGGAAGG + Intergenic
1091251615 11:134148648-134148670 TTCATCAACAATAAACAGGATGG + Exonic
1091280417 11:134378740-134378762 CTCATTCCCAATAAAGATGAAGG + Intronic
1091432375 12:447454-447476 GACATTGAGAATAAAGAGGAAGG + Intergenic
1092925270 12:13266374-13266396 TTCTTTGACAAAAAAGAAGAGGG + Intergenic
1093352363 12:18119081-18119103 TAAATTTTCAATATAGAGGAAGG + Intronic
1094369528 12:29722388-29722410 TTCATTGTCATCACAGAGTACGG - Intronic
1094719243 12:33046057-33046079 TTCATTGTAAATAGGGAGGAAGG + Intergenic
1097919645 12:65057739-65057761 TTCTTTGGCAATAAAAAGAAGGG - Intronic
1098969862 12:76840722-76840744 TTCTTTATCATTAAAGAGCAAGG + Intronic
1099208631 12:79757724-79757746 TTTATTGTAAATAATGATGAGGG + Intergenic
1099297365 12:80845315-80845337 TTCATTTTAATTACAGAGGAAGG - Intronic
1099548544 12:84014156-84014178 TTCATTGTCCATCCAGAGGTTGG - Intergenic
1099659027 12:85532033-85532055 TTAATTGTCCATAAAGAAGATGG + Intergenic
1100876187 12:98964643-98964665 GTCATTGTCAACAACGTGGATGG + Intronic
1103732377 12:123036509-123036531 TTCTTTTTTAATAGAGAGGAGGG - Intronic
1103807161 12:123582629-123582651 TGCATTGTAAACAGAGAGGAAGG + Intergenic
1104098292 12:125581628-125581650 AACATTGTCACTAAAGAGGAAGG + Intronic
1104605541 12:130184949-130184971 GGCATTGGCAATAAAGAGGCTGG - Intergenic
1106172325 13:27298582-27298604 TTCCTTTTTAATAAAGTGGAAGG + Intergenic
1106762010 13:32876625-32876647 TTCAATTTCTATCAAGAGGAAGG + Intergenic
1107944571 13:45406462-45406484 TTCATTGAGAATAAATATGAGGG - Intronic
1109471992 13:62820089-62820111 TTGATTCTCAGTAAAGTGGATGG + Intergenic
1109919570 13:69038220-69038242 TCCATTGTCAATAAACATGAGGG + Intergenic
1110785536 13:79520575-79520597 TTTCTTTACAATAAAGAGGAAGG - Intronic
1110903040 13:80848156-80848178 TTACTTGTCAATTAAAAGGAGGG - Intergenic
1110907245 13:80907123-80907145 TTCCATGGCAAAAAAGAGGAAGG + Intergenic
1111675257 13:91379004-91379026 TTCATTTTCAGAAAGGAGGAAGG - Intergenic
1112306773 13:98281451-98281473 TGCACTGTGATTAAAGAGGATGG - Intronic
1112841081 13:103578449-103578471 ATCACAGTCAATAAAGTGGAAGG + Intergenic
1113192487 13:107765667-107765689 TTTATTATAAATAAAAAGGATGG - Intronic
1113201773 13:107874372-107874394 TTAATTGCCAACAGAGAGGAGGG + Intergenic
1115750387 14:36483454-36483476 TTCAGTGATAATAGAGAGGATGG - Intronic
1115862379 14:37701621-37701643 TTCTTGGACACTAAAGAGGAGGG + Intronic
1116730605 14:48616820-48616842 TTCATTTTTAAGAAAGAGAATGG + Intergenic
1116892084 14:50278459-50278481 TTAATTTTTAATAAAGGGGAGGG + Intronic
1116979040 14:51148473-51148495 TTCAGTGTCAAAAAATAGAAAGG - Intergenic
1117211035 14:53500404-53500426 TTATTTGTCAATAAACAGAAAGG + Intergenic
1117339031 14:54778199-54778221 TTCAGTATGAACAAAGAGGAAGG - Intronic
1118741007 14:68739088-68739110 TAAATTGTCATTAAAGAGGTTGG + Intergenic
1120027383 14:79601509-79601531 TACCTTGGCAATAAAGAGGGAGG - Intronic
1121627426 14:95396437-95396459 TTCATTATCTATAAAGGGGAAGG - Intergenic
1122368876 14:101216419-101216441 TTTTTTGTTAATAAACAGGAAGG + Intergenic
1123046594 14:105520483-105520505 TTATTTGGCAATAAAAAGGAAGG + Intergenic
1127799565 15:62466209-62466231 TTCATTGTCACTAAACAGAGAGG - Intronic
1130714413 15:86317361-86317383 TTCCTTGGTAATAAAGAGCAAGG + Intronic
1132115551 15:99133006-99133028 CTCATTGTCTAGATAGAGGAGGG - Exonic
1134024899 16:10946139-10946161 TTCAGTGTCAAGAAATAGGCAGG + Intronic
1138637305 16:58351361-58351383 TTAATTTTCAAGAAAGAGGAGGG + Intronic
1139079667 16:63500680-63500702 TTCCTTTTCAGGAAAGAGGATGG - Intergenic
1139460212 16:67116044-67116066 TTAGATGTCAAGAAAGAGGAAGG - Intronic
1140091460 16:71842448-71842470 TGCATTGTCAAAAAAGAGTTGGG + Intergenic
1140538032 16:75729067-75729089 GTCATTGTCAAAAAATAGAATGG - Intronic
1142668598 17:1476790-1476812 TTCATTCTCAAACAAGAAGAAGG + Intronic
1143167214 17:4902788-4902810 GTCATTGGCAATGAAGAGGCTGG + Exonic
1143467162 17:7145166-7145188 TTCAATGTCCCTCAAGAGGATGG - Intergenic
1143514572 17:7413405-7413427 GCCAGTGTCAAGAAAGAGGAGGG + Intronic
1147540486 17:41353246-41353268 TACATTGGCCAGAAAGAGGAGGG + Intergenic
1150386195 17:64763207-64763229 TTCATAGTCACTAAAGAGTTGGG - Intergenic
1150976815 17:70096727-70096749 TTGATTCTCAATAAAGGAGAAGG - Intronic
1151341262 17:73472379-73472401 GTCTTTATCAATAAATAGGAGGG + Intronic
1153097297 18:1421572-1421594 TTTAATGTCATTAAGGAGGAAGG + Intergenic
1155443403 18:25885140-25885162 TTCATCTTGAATAAAGAAGAGGG + Intergenic
1155731910 18:29170875-29170897 TTCATTGGCAGTAAAGAGTCAGG - Intergenic
1156821137 18:41374286-41374308 TTTGTTGTCTATAAAGAGGTGGG - Intergenic
1156835575 18:41549538-41549560 TACATTGGCAGTGAAGAGGAGGG - Intergenic
1157135960 18:45055764-45055786 CTAATTGTTAATAAAGAGGATGG - Intronic
1161515538 19:4694149-4694171 TTCACTGTAAATAAAGAAAAAGG - Intronic
1161827868 19:6581188-6581210 TTCAATGTCCATTAACAGGAAGG - Intergenic
1166831196 19:45640726-45640748 TTCATTTTTAGTAAAGACGAGGG + Intronic
926358237 2:12060949-12060971 TTCACTGCCAATAAAGATGTTGG + Intergenic
927726702 2:25430200-25430222 TGCAATGTCAATAAACAGTATGG - Intronic
928647423 2:33369397-33369419 TTCATTGACATTAAAGATGCTGG + Intronic
928842215 2:35623564-35623586 TTCATTTTTAATGCAGAGGATGG - Intergenic
929134985 2:38615024-38615046 TTGATTGTCACTACTGAGGATGG - Intergenic
929343924 2:40857420-40857442 TTATTTGGCAATAAAAAGGAAGG + Intergenic
930489909 2:52056324-52056346 ATGATTGTGAATAAAGAGGCAGG - Intergenic
931741733 2:65251882-65251904 TTTATTTCCAATAAAGAGGGAGG - Intronic
931845807 2:66202883-66202905 TATATTGTAAATAAAAAGGATGG + Intergenic
935657074 2:105432439-105432461 TTCAATGTAAATAAAGTTGAAGG + Intronic
935930465 2:108118653-108118675 TTCAGTGTCAAGAATGAGTAAGG - Intergenic
938149197 2:128867387-128867409 TTAATTGTTCATTAAGAGGAAGG + Intergenic
943269706 2:185783408-185783430 TTCATTTTTAAAAAAGATGATGG - Intronic
943400285 2:187400686-187400708 TTATTTGGCAATAAAGAGGAAGG + Intronic
943464236 2:188208803-188208825 TTCTTTGGCAATACAGAAGAAGG - Intergenic
943546262 2:189283167-189283189 TTGTTTGAAAATAAAGAGGAAGG + Intergenic
943836231 2:192517165-192517187 TTCAGTGTCAGTAAAATGGAAGG + Intergenic
944323425 2:198375910-198375932 TTCTATGTCAATCAAGATGAGGG - Intronic
945617010 2:212083951-212083973 TTCATTGTCAAAGAATAGGCAGG - Intronic
945778543 2:214137986-214138008 TTCATTGGCTCTATAGAGGAGGG + Intronic
945809710 2:214533934-214533956 GTCATTGCCAATAAAATGGATGG + Intronic
946217668 2:218198219-218198241 TTCATTCTAAATAAAAAGAAGGG + Intergenic
947072619 2:226307721-226307743 TTTTTTGTTATTAAAGAGGAAGG + Intergenic
947769737 2:232661479-232661501 TTATTTGGCAATAAAAAGGAAGG - Intronic
948532204 2:238616395-238616417 TTCATTGTTAATTAAGATGTTGG + Intergenic
948975803 2:241463169-241463191 TGGATGGTCAACAAAGAGGATGG + Intronic
1169610393 20:7373222-7373244 TCCATTCCCAAAAAAGAGGATGG - Intergenic
1170331902 20:15221685-15221707 TTCTTTTTTAATATAGAGGATGG + Intronic
1171415324 20:24975363-24975385 TTCATTGTTAGTATAAAGGAAGG - Intronic
1172986392 20:38994636-38994658 ATAATTGTCAATAAAGGGGGGGG - Intronic
1173128792 20:40367016-40367038 TTCATTGCCAAGAAAAAGCATGG + Intergenic
1174218051 20:48932298-48932320 TTGGTTGTGAGTAAAGAGGACGG + Intronic
1174936912 20:54881051-54881073 CTCATTGTCAAGAAACAAGATGG - Intergenic
1175567111 20:59989081-59989103 TTCATTGTCAATAAAGAGGAGGG + Exonic
1178083162 21:29086608-29086630 TTCATTGATAATAAAGCTGATGG + Intronic
1179155767 21:38849773-38849795 TTCACTGTGAAGACAGAGGAAGG + Intergenic
1182039453 22:27225040-27225062 GTCAATGTCATTAAAAAGGAAGG - Intergenic
1184317496 22:43707653-43707675 TACATTTTCATTAAAGAGTAGGG + Intronic
951062250 3:18222930-18222952 TTCATTGTGAAGAAAGCAGAGGG + Intronic
951246935 3:20351972-20351994 TTCATTTGCAATAACGTGGATGG - Intergenic
954591968 3:51790576-51790598 TTAATTGTCAATAAGAAGAATGG - Intergenic
955091358 3:55753758-55753780 TCCATTGGCAAGAAAGAGAATGG + Intronic
955177596 3:56632162-56632184 TGCATTTTTAATGAAGAGGAGGG - Intronic
955422707 3:58754969-58754991 TTCATTATCAATGAAGATCATGG + Intronic
955651508 3:61199192-61199214 TTCATTGAGAATAAAGAAAATGG + Intronic
955882307 3:63560528-63560550 ATCTTTGTGAATAAAGAGGATGG - Intronic
956491384 3:69775651-69775673 TTCATTTTTAATAAAAAGAATGG - Intronic
956719389 3:72104608-72104630 TTCATTGTTACTCAAGAGGTGGG + Intergenic
958105522 3:89067745-89067767 TTCTCTGTCACTAAAGAGGATGG + Intergenic
958987087 3:100793861-100793883 TTCATTTTCAACCAAGAGGCAGG + Intronic
960011468 3:112838835-112838857 ATTATTCTCAATAAAGAAGATGG + Intronic
960678030 3:120216071-120216093 TTTTGTCTCAATAAAGAGGAAGG - Intronic
962030350 3:131593462-131593484 TTCATTGTAAATATATAGAAAGG + Intronic
964017355 3:151963844-151963866 AACATTGTCTATAAAGAGAAAGG + Intergenic
964208110 3:154197184-154197206 TTCATGCTCAATAGAGAGAAAGG - Intronic
964854502 3:161131668-161131690 TTCATCTACAAAAAAGAGGATGG - Intronic
966366515 3:179193973-179193995 TTAAATACCAATAAAGAGGATGG - Intronic
971688106 4:29796971-29796993 TCCATTGTCTATAATGATGAAGG - Intergenic
971770007 4:30883939-30883961 CAATTTGTCAATAAAGAGGAAGG - Intronic
971829661 4:31674541-31674563 ATTATTGTCAAAAAAGAGGCTGG + Intergenic
973872094 4:55176829-55176851 TTCATTAGCAATAATGTGGAGGG + Intergenic
974414813 4:61593914-61593936 GTTATTGTCTTTAAAGAGGAGGG - Intronic
974768669 4:66381857-66381879 TTCATTCTGAATCAAAAGGAAGG - Intergenic
975074176 4:70184156-70184178 TTCATTGTCCAAAAACAGGCAGG + Intergenic
975337880 4:73202183-73202205 TTCATTGTCTGAAAAGAGGTGGG - Intronic
976477121 4:85497053-85497075 TACACTGTTGATAAAGAGGAAGG + Intronic
976904506 4:90219621-90219643 TTCATTTACAATGAAGAGCAAGG - Intronic
977129089 4:93211300-93211322 TTCATTGGTAATAAATAGTATGG + Intronic
978173150 4:105698205-105698227 TTCATTTACATTAATGAGGAAGG - Intronic
978362065 4:107941100-107941122 TTTATTGTTAAGAAAAAGGAGGG + Intronic
979213848 4:118139205-118139227 TTCATTTTCAGTACAGAGGAAGG - Intronic
979342999 4:119550231-119550253 TTCTTTGTAAATAAAAAGAAAGG - Intronic
979441610 4:120756799-120756821 TTCATTGTTAATAAATAAGAAGG - Intronic
979694701 4:123599828-123599850 TTTATTCTCAGTACAGAGGAAGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981918708 4:150063217-150063239 TTCATTGTCCAACAAGAGGAAGG - Intergenic
982129796 4:152218131-152218153 TTTATTGTCAAAACAGATGATGG - Intergenic
982660143 4:158196915-158196937 GTAATTGTCAATTAAGAGAAAGG + Intergenic
983276615 4:165625325-165625347 TTCAATGTCAACATAGAGCAAGG - Intergenic
984012227 4:174384164-174384186 TTCATTGTCACCTAGGAGGAAGG + Intergenic
984482284 4:180320975-180320997 TTCATTGACAATTAAGTAGAAGG + Intergenic
984981378 4:185285391-185285413 CTCATGGTCAATAATGAGTATGG - Intronic
985043930 4:185921055-185921077 TTCCTTGTCAATTACGAGGCTGG + Intronic
988809999 5:34775556-34775578 TTCATTTTAAATAGAGATGAGGG - Intronic
992510339 5:77426624-77426646 GTCATTGTCATTAGAAAGGAAGG - Exonic
993612357 5:90070989-90071011 TTCATTTTGAATAAACAGAAGGG + Intergenic
993905948 5:93622751-93622773 TTCATTGTTACTCAATAGGAAGG + Intronic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
995770066 5:115659361-115659383 TTCATTGTCAGTAATGGAGAGGG + Intergenic
996328012 5:122297939-122297961 TTCCTTGTTAACAAAGAGGGAGG + Intergenic
997073404 5:130643333-130643355 TTTACTGTCAATAAATAGGTGGG - Intergenic
999376719 5:151091842-151091864 TTCATTGTCACAACTGAGGAGGG + Intronic
999499836 5:152135816-152135838 TTCAGTGTCAAGAACTAGGAAGG - Intergenic
999886066 5:155924327-155924349 TTTATTGTCAGCACAGAGGAAGG + Intronic
1001045543 5:168368744-168368766 TTCATTCTCCATAAGGAAGAGGG + Intronic
1003734511 6:8863496-8863518 TTCATTATCAATACAAGGGAAGG - Intergenic
1006687790 6:35851820-35851842 TCCTTTTTCAATTAAGAGGAAGG + Intronic
1007650527 6:43417661-43417683 TTCACAGTCCATAAAGTGGAAGG - Intergenic
1008910060 6:56722331-56722353 TTTATTGTCAAAAAAGAACAAGG - Intronic
1010300797 6:74256169-74256191 TTAATTTTAAATAAATAGGAAGG - Intergenic
1011111963 6:83848755-83848777 TTCATGGTCCCCAAAGAGGAAGG - Intergenic
1011720136 6:90147530-90147552 TTCATTGTCTAGAAGGAGCAAGG + Intronic
1012979067 6:105811003-105811025 TACATAGTTAGTAAAGAGGAGGG + Intergenic
1014330106 6:120053868-120053890 TTTATTGTAGATAAAGAGGTTGG - Intergenic
1014334550 6:120116629-120116651 TTCATACTAAATACAGAGGAAGG + Intergenic
1014759774 6:125343751-125343773 TGCAGTGTAAAAAAAGAGGATGG - Intergenic
1017855021 6:158343162-158343184 TTCTTTGTCTATGAAGGGGAGGG + Intronic
1018215227 6:161519753-161519775 TGCATCGTCAATGAAGATGATGG - Intronic
1018878688 6:167851626-167851648 TTCCCTGTCTATAAAGTGGAGGG - Intronic
1019849108 7:3536920-3536942 TTAATAGTCAATAAAGAATATGG - Intronic
1022065585 7:26852613-26852635 TTCTTTGTCTCTAAAGAGAATGG - Intronic
1026808114 7:73440482-73440504 TTTATTGTCTTCAAAGAGGAAGG - Exonic
1027709806 7:81585943-81585965 TTAATTTTAAATAAAGAGAAAGG - Intergenic
1028726484 7:94093245-94093267 TTCATTAGAATTAAAGAGGAGGG - Intergenic
1029981452 7:104883521-104883543 TTCATTTTCATTAAATAGTAAGG - Intronic
1030418813 7:109280904-109280926 TAAATTGTCAAAATAGAGGAGGG - Intergenic
1030518821 7:110571277-110571299 TCCATTCTCAGCAAAGAGGATGG + Intergenic
1030674685 7:112372121-112372143 TTATTTGTCAATAAAAAGAAAGG + Intergenic
1031213674 7:118862460-118862482 TCCATTGTTCATAAAGTGGATGG - Intergenic
1031741706 7:125440597-125440619 AACACTGTCAATAAACAGGATGG - Intergenic
1032803265 7:135333494-135333516 TTCTTTGTCCATAAAGAGGTAGG + Intergenic
1032928983 7:136643184-136643206 TTCACAGTCATTAAAGAAGAGGG + Intergenic
1035667050 8:1387133-1387155 ATCATTGACAGTAAGGAGGATGG + Intergenic
1036984757 8:13516108-13516130 TTGATTGTAAATAAAGTAGAAGG - Intergenic
1037097233 8:15000437-15000459 ATAATTTTCATTAAAGAGGAAGG - Intronic
1037530651 8:19769548-19769570 TTCATTGTGAGGTAAGAGGAAGG + Intergenic
1037759005 8:21729561-21729583 TTCACTGTCATTAAAGAAGACGG + Intronic
1038815243 8:30896221-30896243 TTCATTTGATATAAAGAGGATGG - Intergenic
1040994004 8:53382722-53382744 TTAAGTGTCAAGAATGAGGAAGG - Intergenic
1041288650 8:56286313-56286335 ATCATTTTCAATACAGAAGAAGG + Intergenic
1041352558 8:56962760-56962782 TTCATTATCAAGAATGAGTATGG - Exonic
1041430102 8:57771034-57771056 TTCAATGTAAAGAAAGTGGAAGG + Intergenic
1042758746 8:72247924-72247946 TTCCTTGGCAACAAAGAAGAAGG - Intergenic
1043772647 8:84224301-84224323 TTCATTCTCAAAAAGGTGGATGG + Intronic
1044500419 8:92948309-92948331 TGCATCTTCAGTAAAGAGGAAGG + Intronic
1044771614 8:95641577-95641599 TTCAGTGTCAAGAAGGAAGATGG - Intergenic
1045901530 8:107287132-107287154 CTCAATGTGAATAAAGAGGCTGG + Intronic
1046249756 8:111613972-111613994 TTTATTGTAAATATAGAGAATGG + Intergenic
1046792237 8:118334494-118334516 TTTATTAAAAATAAAGAGGAGGG - Intronic
1047907952 8:129492955-129492977 TTCATTCACACTCAAGAGGAGGG + Intergenic
1049910839 9:266198-266220 TTCCTTGTTAGCAAAGAGGAAGG - Intronic
1050690954 9:8225352-8225374 ATCATTTTCAAGAAAGAGAAGGG - Intergenic
1052532361 9:29703798-29703820 TTCATTGTCTGTAAAAATGAAGG + Intergenic
1055444173 9:76366547-76366569 TTCATTATCACGGAAGAGGAAGG + Intergenic
1058251991 9:102710633-102710655 TTAATAGTCAATAAAGTAGAGGG - Intergenic
1058315776 9:103563988-103564010 TACATTGTCAAGTAAGAAGAAGG - Intergenic
1058915414 9:109559922-109559944 TACATTGTCAACACAGAGAAGGG + Intergenic
1058947565 9:109873036-109873058 TTGAGAGTCAAGAAAGAGGAAGG + Intronic
1061236894 9:129348627-129348649 TTCATTGTCATTAGAGGGGATGG - Intergenic
1061617028 9:131787113-131787135 CTCCTTGTCAGTGAAGAGGATGG + Intergenic
1186013770 X:5167580-5167602 TTTGTTGTCAATAAAAAAGATGG - Intergenic
1186562305 X:10625562-10625584 TTCATTATTGATAAAGAAGACGG - Intronic
1187372307 X:18720161-18720183 TTCAGTGTCATTGAAGAGAAAGG + Intronic
1187815797 X:23230504-23230526 TTCATTGACAATAACTAGAAAGG + Intergenic
1190401275 X:50037691-50037713 TTCATTGTTAATGAAGGGGAAGG + Intronic
1190990926 X:55549443-55549465 TTCATTTTGAACACAGAGGATGG - Intergenic
1191108615 X:56788242-56788264 TCCCATGTGAATAAAGAGGAAGG - Intergenic
1191604687 X:63048060-63048082 TTCAATGTGAATAAAAAAGAAGG - Intergenic
1191826405 X:65370072-65370094 TTCTTTTTCAATATAGACGAGGG - Intronic
1193124131 X:77853151-77853173 TTCCTTGTCATTCAAGAGAATGG + Intronic
1195332313 X:103813226-103813248 TTTATTGTCTATAAAAAGAAGGG + Intergenic
1197101594 X:122662484-122662506 TTCATTGTCTTTAAAGGTGAAGG - Intergenic
1199224794 X:145359834-145359856 TTGATTTTTAATAAAAAGGAAGG + Intergenic
1199519611 X:148720747-148720769 TACATTGTCAAGTAAGAGGGTGG + Intronic