ID: 1175568278

View in Genome Browser
Species Human (GRCh38)
Location 20:59998279-59998301
Sequence TGAGCTTGGAGGAGACTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 299}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175568267_1175568278 28 Left 1175568267 20:59998228-59998250 CCCAGGAGCTGTGCCTCAGTCTC 0: 1
1: 1
2: 2
3: 29
4: 244
Right 1175568278 20:59998279-59998301 TGAGCTTGGAGGAGACTGGCAGG 0: 1
1: 0
2: 1
3: 29
4: 299
1175568272_1175568278 15 Left 1175568272 20:59998241-59998263 CCTCAGTCTCCTCCTTGGAGGGA 0: 1
1: 0
2: 4
3: 35
4: 335
Right 1175568278 20:59998279-59998301 TGAGCTTGGAGGAGACTGGCAGG 0: 1
1: 0
2: 1
3: 29
4: 299
1175568273_1175568278 6 Left 1175568273 20:59998250-59998272 CCTCCTTGGAGGGAGAGAGTGAA 0: 1
1: 1
2: 2
3: 21
4: 282
Right 1175568278 20:59998279-59998301 TGAGCTTGGAGGAGACTGGCAGG 0: 1
1: 0
2: 1
3: 29
4: 299
1175568268_1175568278 27 Left 1175568268 20:59998229-59998251 CCAGGAGCTGTGCCTCAGTCTCC 0: 1
1: 1
2: 6
3: 47
4: 444
Right 1175568278 20:59998279-59998301 TGAGCTTGGAGGAGACTGGCAGG 0: 1
1: 0
2: 1
3: 29
4: 299
1175568274_1175568278 3 Left 1175568274 20:59998253-59998275 CCTTGGAGGGAGAGAGTGAAAGC 0: 1
1: 0
2: 2
3: 35
4: 343
Right 1175568278 20:59998279-59998301 TGAGCTTGGAGGAGACTGGCAGG 0: 1
1: 0
2: 1
3: 29
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175568278 Original CRISPR TGAGCTTGGAGGAGACTGGC AGG Intronic
900796134 1:4709384-4709406 TGAGCTTGGTGGAGTGTGGTGGG + Intronic
900968906 1:5978457-5978479 TGAGCCAGGAGGTCACTGGCAGG + Intronic
901828235 1:11876510-11876532 TGAGGAGGGAGGAGAGTGGCGGG + Intergenic
902437076 1:16405181-16405203 TGATGGTGGAGGAGGCTGGCAGG - Intronic
902611376 1:17599470-17599492 TGAGCTTAGAAGAGGTTGGCTGG - Intronic
902700878 1:18171077-18171099 TGAGCTTGGAAGACACTGTCTGG + Intronic
903666016 1:25008136-25008158 TGTGATTGGTAGAGACTGGCTGG - Intergenic
903779440 1:25811824-25811846 TGAGCTGGGAGGAGGCTGCCCGG + Exonic
905451559 1:38060243-38060265 TGGTCTTGGAGGAGCCTGGGTGG + Intergenic
905856627 1:41318793-41318815 TGAGCTTGGAGGAGATCCCCTGG - Intergenic
906669704 1:47645524-47645546 TGAGATCGGAGGAGACTTCCTGG + Intergenic
907483642 1:54761748-54761770 TGAGGTTGGAGGGGACAAGCTGG - Intronic
908155523 1:61348829-61348851 TGAGCATGGCGGACACTGTCTGG - Intronic
911025181 1:93427933-93427955 TGAGCTGAGAGGAGCCTGCCAGG + Intergenic
912600745 1:110930877-110930899 TCAGCTTTTAGGAGACGGGCTGG + Intergenic
914847169 1:151289694-151289716 GGCGCTTGGAGGAGACTGCTGGG + Exonic
915073974 1:153294004-153294026 TGAGCAGGGAGGAGCCAGGCAGG - Intergenic
915460601 1:156068482-156068504 TAAGCTTGGAGGAGTCAGCCTGG - Intronic
915465913 1:156097824-156097846 TGGGCTTGGAGGAGAGTGAGAGG - Intronic
915720015 1:157978116-157978138 TGAGCTTGGAGGACAGAGGTGGG - Intergenic
915943262 1:160132364-160132386 TGAGCTTTTAGGAGACTACCTGG + Intronic
917520256 1:175742506-175742528 TGAGCTTTGCAGAGACTGGCTGG - Intronic
918076913 1:181177456-181177478 GGAGCTGGGAGGAGCCTAGCTGG + Intergenic
919070854 1:192753026-192753048 TGAGATGGGAGGAGATGGGCTGG - Intergenic
919443537 1:197670821-197670843 TGAACTTGGAGCAGGTTGGCTGG - Intronic
919862318 1:201748461-201748483 AGAGCTTGGTGGAGGCTGGTAGG - Intronic
920937425 1:210448576-210448598 TGAGATTGGAGGAGGCAGGATGG + Intronic
922112647 1:222576868-222576890 AGAGCTCAGAGGAGCCTGGCTGG - Intronic
922612070 1:226938178-226938200 AGAGCTTGGAGGAAACAGGGAGG + Intronic
924878979 1:248137150-248137172 TGAGGCGGGAGGAGACTGGAGGG - Intergenic
1064614434 10:17137876-17137898 TGACCTTGAAGGAAAGTGGCTGG + Intergenic
1066997662 10:42578508-42578530 TGAGCTTGGCTGAGACTCCCTGG - Intronic
1067055434 10:43047073-43047095 TGACCTTGGAAGAGACACGCTGG + Intergenic
1068265936 10:54649878-54649900 TGAGCTTTGAGGATAGTAGCTGG - Intronic
1069068924 10:63974426-63974448 TGATGTTGGAGGAGACTAGCAGG + Intergenic
1069543494 10:69313014-69313036 TGAGTAAGGAGGAGGCTGGCAGG + Intronic
1069799233 10:71071983-71072005 TGATCTGGGAGGAGAGTGGCTGG + Intergenic
1069806913 10:71131951-71131973 GGAGCTAGGAGGAATCTGGCTGG - Intergenic
1070351545 10:75597452-75597474 TGAGCCAGGAGGGGACTGGGAGG + Intronic
1070915603 10:80152551-80152573 TGAGGTTCGAGGGGACTGGGTGG + Exonic
1070942250 10:80357655-80357677 TGGGCCTGGTGGAGACTGGACGG - Intronic
1071785313 10:88892893-88892915 TGAGCTTTCAGGCAACTGGCAGG + Intronic
1073111304 10:101064517-101064539 AGAGGTTTGAGGTGACTGGCTGG + Exonic
1074153676 10:110780865-110780887 TGAGCCAGCTGGAGACTGGCAGG - Exonic
1074351269 10:112739272-112739294 TGAGCTGGGAGGATATTGGGAGG - Intronic
1074549059 10:114426393-114426415 TGAGCTTGGACAAGCCAGGCAGG + Intergenic
1075002911 10:118810977-118810999 GGAGCTTGGGGTAGACTGCCCGG + Intergenic
1075642737 10:124076479-124076501 TGTGCTGGGAGGGGTCTGGCTGG - Intronic
1076535184 10:131172494-131172516 TGAGGCTGGAGGAAACTGGGAGG + Intronic
1076544109 10:131232302-131232324 TGAGCTGGGAGGAGCCCAGCAGG + Intronic
1076826341 10:132971541-132971563 TCAGCTTTGAGGAGGCTGGAAGG - Intergenic
1078653369 11:13216298-13216320 TGAGCTTGAAGGGGACTTGTCGG - Intergenic
1079106102 11:17573380-17573402 TCAGGCTGGAGGAGACTGGAGGG - Intronic
1079251273 11:18790021-18790043 TCACCTTGGAGGAGACTGGATGG - Intronic
1080743390 11:35085970-35085992 AGAGCTAGAAGGAGGCTGGCAGG + Intergenic
1084785060 11:71437402-71437424 TGAGCTGGGAGGGGAGTGGGGGG + Intronic
1085149620 11:74239543-74239565 TGAGCTTAGAGTAGACTGGTAGG - Intronic
1085677636 11:78539340-78539362 TGAGGTTTGGGGAGACAGGCAGG + Intronic
1088183631 11:107139588-107139610 TGTGCTTTGAAGAGCCTGGCTGG - Intergenic
1088234128 11:107704303-107704325 TGAGTTTAGAGAAGACTGGAAGG + Intergenic
1088558895 11:111092175-111092197 TGATCTTGGAAGAGCTTGGCTGG + Intergenic
1090990515 11:131812931-131812953 TGAGCCAGCTGGAGACTGGCAGG - Intronic
1091678851 12:2511739-2511761 TGAGCAAGGAGGAGGCTGGCAGG - Intronic
1091977558 12:4837542-4837564 TGGAATTGGAGGACACTGGCTGG + Intronic
1092503793 12:9074241-9074263 AGAGCTTTCAGGAGAATGGCAGG + Intronic
1094484316 12:30912183-30912205 TGAGCTTGGAGGGGATGGGTTGG + Intergenic
1095405891 12:41866814-41866836 TGAGCCTGGAGGAGGCTGGCAGG - Intergenic
1095563941 12:43598587-43598609 TGTGCTTGGTGGAGAATGTCAGG + Intergenic
1096559543 12:52425641-52425663 AGAGCTAGGAGGAGGCTGGAGGG + Intronic
1096860617 12:54525070-54525092 TGAGCCTGGGAGAGACTGGTAGG + Intronic
1098403054 12:70094052-70094074 TGAGCTGGGAGGAGGGTGGGAGG + Intergenic
1100539517 12:95544390-95544412 TGAGGTTGAAAGAGAGTGGCTGG - Intronic
1100800593 12:98226494-98226516 GAAGCTTGTAGGATACTGGCTGG - Intergenic
1100875274 12:98955400-98955422 GGAGCTTGCAGGAGAATGACAGG + Intronic
1101049395 12:100845333-100845355 TGACCTGGGAGAGGACTGGCTGG + Intronic
1101423521 12:104568498-104568520 TGAGATGGGAAGAGAATGGCTGG + Intronic
1103964919 12:124632593-124632615 TGAGGTGGGAGGAGAGAGGCCGG + Intergenic
1104168301 12:126255279-126255301 TGAGATGGGAGCAGAATGGCTGG + Intergenic
1106235493 13:27857308-27857330 TGCGGTTGAAGGAGCCTGGCTGG + Intergenic
1107292825 13:38876319-38876341 TGGGGTTGCAGGTGACTGGCAGG - Exonic
1107986562 13:45781464-45781486 TGTGATTGGAGGAGGGTGGCTGG + Exonic
1108464212 13:50698104-50698126 TGAGGTTGGAGATGCCTGGCAGG + Intronic
1109851234 13:68067026-68067048 TGAGATAGGAAGAGACTGACAGG + Intergenic
1113292375 13:108921165-108921187 TGAGGTGGGAAGAGACTGGCAGG - Intronic
1113597053 13:111540631-111540653 TGAGCTGGGTGGGGAGTGGCGGG + Intergenic
1113930743 13:113967675-113967697 TGAGGTTGGAGGAGACCCTCTGG - Intergenic
1115410520 14:33068888-33068910 TGAGCAAGGAGGACAGTGGCAGG + Intronic
1118025459 14:61763441-61763463 AGTGCATGGAGGGGACTGGCAGG - Intronic
1118997510 14:70850102-70850124 TGAGCAAGGAGGAGACTCGGAGG + Intergenic
1119109724 14:71960138-71960160 TCAGTTTGGAGTAGACTTGCAGG + Intronic
1120440968 14:84538816-84538838 TGAGATTGTAGACGACTGGCAGG + Intergenic
1120761418 14:88288911-88288933 TGGGCTAGGAAGAGACTGGAGGG - Intronic
1123478606 15:20611169-20611191 TCAGCTTGGAGAAGACAGCCAGG - Intergenic
1123639407 15:22389216-22389238 TCAGCTTGGAGAAGACAGCCAGG + Intergenic
1126238024 15:46408247-46408269 TCAGTTTGCAGGAGACTGGTGGG + Intergenic
1126314422 15:47354740-47354762 TCGGCTTGGTGCAGACTGGCAGG - Intronic
1126462285 15:48926867-48926889 GGAGTCTGGATGAGACTGGCAGG - Intronic
1127648508 15:60982993-60983015 AGACCTTGAAGAAGACTGGCGGG + Intronic
1128347646 15:66864640-66864662 TTAGGTTGGAGGAGGCTGGGAGG + Intergenic
1128422442 15:67506424-67506446 AGGGCTGGGAGGAGCCTGGCTGG + Intergenic
1129326118 15:74801050-74801072 TGATCGTGGAGGAGAAGGGCGGG + Exonic
1131090529 15:89621664-89621686 AGAGATTGGAGGTGACTGGGTGG + Intronic
1132238103 15:100237128-100237150 GGAGCTGGGAGGAACCTGGCTGG - Intronic
1133767950 16:8850734-8850756 TCAGGTTGGAGGAGCCTGCCTGG - Intergenic
1134055791 16:11169020-11169042 TGAGCTTGGAGGAGAGGCCCTGG - Intronic
1135761758 16:25143633-25143655 TTATCTGGGAGAAGACTGGCAGG - Intronic
1135843324 16:25895944-25895966 TGGGGATGGAGGAGACTGGTGGG + Intronic
1136121038 16:28134508-28134530 TGGGCATGGAGGAGATTGGAGGG - Intronic
1136450360 16:30351260-30351282 AGTGCCTGGAGGACACTGGCAGG + Exonic
1136450777 16:30353344-30353366 TGAGCTTGGAGGACAGAGGAGGG - Intronic
1139079309 16:63495699-63495721 TGAGTTTGGATCAGACTGCCTGG + Intergenic
1139178647 16:64719484-64719506 TGAGCTTGGAGTAGAATTACTGG - Intergenic
1143181391 17:4986524-4986546 GGAGCGGGGAGAAGACTGGCAGG + Intronic
1143384917 17:6523477-6523499 TGAGCTGGGAGGGCACTGGAGGG - Intronic
1143746994 17:9002407-9002429 AGAGCTTGGAGGAGGCGCGCCGG + Intergenic
1143767913 17:9149717-9149739 GGAGCTTGGAGAGGACTGGGTGG + Intronic
1144012510 17:11163170-11163192 TGATAATGGAGGAGACTGTCAGG + Intergenic
1144307663 17:13983839-13983861 TTAGCATGGAGGAGACTGCATGG + Intergenic
1146424147 17:32719863-32719885 TGTGGTTGGAGGACACTGACAGG - Intronic
1146780466 17:35666711-35666733 TGAGCTGGTAGGAGACAGGAGGG - Intronic
1146789124 17:35741743-35741765 GGAGCTGGGAGGGGACTGGAGGG - Exonic
1147572419 17:41579603-41579625 TGAGGTTGGAGGAGTCTTCCCGG + Intergenic
1148209529 17:45799916-45799938 TGAGCTTGTAGGGGTGTGGCAGG - Intronic
1148210692 17:45806776-45806798 TGCTCTTGGAGGGGCCTGGCAGG - Intronic
1148328511 17:46798462-46798484 TCAGCTTGCAGGAGAATAGCTGG + Intronic
1148401662 17:47367666-47367688 TGAGCTTGAAGAAGCCTGACAGG + Intronic
1149142385 17:53447977-53447999 TGAGATTACAGGAAACTGGCTGG + Intergenic
1149968152 17:61188876-61188898 TGAGGTGGGAGGAGCCTGGGAGG + Intronic
1150102606 17:62437474-62437496 TGAGCTTGTAAGGGACTGGGAGG - Intronic
1150313173 17:64146163-64146185 GGAGCTGGGAGGGGGCTGGCGGG + Intergenic
1150525250 17:65915933-65915955 TGAACTTGGAAGAGAGTGGTAGG - Intronic
1151393081 17:73801091-73801113 GGAGGTGGGAGGAGGCTGGCAGG + Intergenic
1151627986 17:75289433-75289455 TGAGCTCGGACGAAACTGGCGGG + Intronic
1152089324 17:78238149-78238171 TGAGCTTGGAGGAACCAGCCCGG - Intronic
1152318420 17:79594445-79594467 AGAGCCTGGAGGGGGCTGGCTGG - Intergenic
1152331245 17:79674572-79674594 TGAGCTTGGAGGGGGCTGGAAGG - Intergenic
1153824571 18:8863875-8863897 TGGGCGTGGAGGACACTGGATGG - Intergenic
1153944075 18:10003518-10003540 TGGCTTGGGAGGAGACTGGCAGG - Intergenic
1155106813 18:22675105-22675127 TGAGATAGGAAGGGACTGGCTGG + Intergenic
1155679303 18:28470148-28470170 TGAGATTGGAGAAGAATGGACGG - Intergenic
1155957121 18:31963484-31963506 TGAGCCTGGATGAGGTTGGCTGG - Intergenic
1159078463 18:63708137-63708159 TGAGCTTGGGGGAGAGTGGTAGG + Intronic
1159980269 18:74769955-74769977 TGGGCTTTGAGGAGACAGCCTGG + Intronic
1160278517 18:77463326-77463348 TGAGATTGGAGGAGACAGACAGG + Intergenic
1160621999 18:80178315-80178337 TGAGCTCGGAGGAATCTGGCTGG - Intronic
1160702941 19:517371-517393 TGAGCTGGGTGGAGGCTGGGAGG + Intronic
1160703435 19:518550-518572 TGGGCTGGGAGGGGACTGGGAGG + Intronic
1160869734 19:1271709-1271731 GGAGCTGAGATGAGACTGGCTGG + Intronic
1162894393 19:13756486-13756508 TGGGCTTGGAAGAGCTTGGCTGG + Intronic
1163018206 19:14469641-14469663 AGAGCTTTGGGGAGACTGGGGGG + Intronic
1165393590 19:35551794-35551816 AGAGCTTGGATGACAGTGGCCGG + Intronic
1166348893 19:42184636-42184658 TTAGCAAGGAGGAGACTGTCAGG - Intronic
925539728 2:4953515-4953537 AGAGGTTGGAGGAGTCTGGGAGG - Intergenic
926143294 2:10381362-10381384 TGAGGTGGGAGGAAACTTGCTGG - Intronic
927070834 2:19527958-19527980 TGAACTTGGAGGAAACTGCTAGG - Intergenic
927517114 2:23678524-23678546 TGATATTGGCAGAGACTGGCCGG - Intronic
927517199 2:23679300-23679322 TGATATTGGCAGAGACTGGCTGG + Intronic
928024124 2:27726140-27726162 TGAGATTGAAGGAGACTGTCAGG + Intergenic
931779076 2:65564432-65564454 TGGCCTTGGTGGAGGCTGGCAGG - Intergenic
932161740 2:69466327-69466349 TGACCTTGAAGGAGACATGCTGG - Intronic
932306621 2:70708146-70708168 TAAGCTTGGAGGACAGTGGAAGG + Intronic
932766248 2:74472334-74472356 TGGGCTTGGTGGAGACGGGCAGG - Intronic
934098445 2:88628464-88628486 TCAACGAGGAGGAGACTGGCCGG + Intergenic
934730349 2:96652648-96652670 TGTGGCTGGAGGAGACTGGCTGG + Intergenic
934853244 2:97714121-97714143 TGGGCTGGGTGGTGACTGGCTGG + Intronic
935354840 2:102188122-102188144 TGAGCTTGGAGGTGACTTCGGGG + Intronic
936234619 2:110732512-110732534 TGAGGAGGGAGGAGACGGGCCGG + Intergenic
937352574 2:121175512-121175534 TGAGCTGAAAGGAGACTGGCAGG - Intergenic
937376553 2:121340200-121340222 AGAGCTGGAAGGAGACTGTCAGG + Exonic
938099918 2:128491658-128491680 GGAGGGTGGAGGAGACAGGCTGG - Intergenic
938130799 2:128714437-128714459 GTAGCTGGGAGGAGGCTGGCAGG + Intergenic
939778385 2:146413488-146413510 AGTGCTTGGAGGAGAAGGGCGGG - Intergenic
939988615 2:148856030-148856052 TGACCTTGCAGGAAACTTGCAGG - Intergenic
940478162 2:154192404-154192426 AGAGCTGGGAGGAGAAGGGCGGG - Intronic
940763762 2:157767370-157767392 TGAGCATGCAGAAGACTGTCTGG + Intronic
942369278 2:175264768-175264790 TCAGCCTGGAGGAGAGTTGCCGG + Intergenic
943072510 2:183157216-183157238 TGAGGATGGAGAAGAATGGCAGG + Intronic
943110511 2:183598955-183598977 TAAGCTTGGAGGAGGCAGGAGGG - Intergenic
945410345 2:209499450-209499472 TGAGGTTGGAAGAGTCTGGATGG - Intronic
946307232 2:218863100-218863122 TGATCTTGGAGGGCACTGGTAGG - Intronic
947299817 2:228676504-228676526 TGAGCTAGGAGCAGAGGGGCTGG - Intergenic
947644974 2:231731986-231732008 TGGGCTGGGAGGAGGCTGGGAGG - Intergenic
947736486 2:232457964-232457986 GGAGCTTGGTGGTGATTGGCAGG - Intronic
948574939 2:238943854-238943876 TGACTTTGGTGGAGACTGGCAGG - Intergenic
1169824253 20:9748959-9748981 TAAGTTTGGAGGATACTGGCAGG - Intronic
1171164209 20:22956347-22956369 TGCCCATGGAGGACACTGGCTGG - Intergenic
1171324158 20:24276228-24276250 TGAGCATGGAGGGGTATGGCAGG + Intergenic
1171332532 20:24353491-24353513 TGAGGTGGGAGGAGCCTGGGAGG - Intergenic
1171367495 20:24635799-24635821 TGAGTGTGGAGGAAACTGGAAGG - Intronic
1172052873 20:32132534-32132556 TGAGCGAGGAGGAGAGTGGGAGG + Intronic
1172786838 20:37474152-37474174 AGAGGCTGGAGGAGACGGGCAGG + Intergenic
1172992296 20:39045569-39045591 TGAGCTTGGAGGTGGGAGGCAGG - Intergenic
1174755918 20:53158396-53158418 TGAGCTGGGAGCAGGCAGGCAGG + Intronic
1175480716 20:59308797-59308819 TGTGATTGGAGGATGCTGGCTGG + Intronic
1175568278 20:59998279-59998301 TGAGCTTGGAGGAGACTGGCAGG + Intronic
1176007971 20:62876502-62876524 TGAGCCAGGGCGAGACTGGCTGG - Intergenic
1178446266 21:32646469-32646491 TGATATTGTAGGTGACTGGCAGG + Exonic
1179724334 21:43333419-43333441 TGCGCTTCCAGGAGCCTGGCTGG + Intergenic
1180018019 21:45100269-45100291 TGAGAGTGGAGTAGACAGGCTGG + Intronic
1181098473 22:20522569-20522591 TGAGCTTGCAGGAGAAAGGGAGG + Intronic
1181179444 22:21056551-21056573 TGAACTTGGAAGAGAGGGGCTGG - Intronic
1181205849 22:21251614-21251636 GGAGTATGCAGGAGACTGGCAGG + Intergenic
1182626982 22:31654706-31654728 TAAGCTTGGAGGTGAATGCCTGG - Intronic
1183543046 22:38440997-38441019 TGAGGGTGGGCGAGACTGGCTGG + Intronic
1183597896 22:38823224-38823246 TGAGCCTGAAGGACAATGGCTGG - Exonic
1184256535 22:43290231-43290253 TGTGCTTGGAGGAGAGAGCCAGG - Intronic
1184256539 22:43290259-43290281 TGTGCTTGGAGGAGAGGGCCAGG - Intronic
1184256545 22:43290287-43290309 TGTGCTTGGAGGAGAGAGCCAGG - Intronic
1184256549 22:43290315-43290337 TGTGCTTGGAGGAGAGAGCCAGG - Intronic
1184763728 22:46560942-46560964 GGAGCTGGGTGGAGGCTGGCTGG + Intergenic
950248978 3:11448295-11448317 AGAGCATGGAGGAGCCTGGAAGG - Intronic
952959018 3:38578208-38578230 TGAGCTAGGAGGAGAGGGGAAGG - Intronic
953660471 3:44887959-44887981 TGTGCTTGGAGGAGGCTGAGTGG - Intronic
954533660 3:51341951-51341973 AGAGATGGGAGGAGAATGGCTGG - Intronic
955833336 3:63027476-63027498 AGAGATTGGAGGAGATTGGAGGG - Intergenic
956002979 3:64748744-64748766 TGGGCTTGCAGGAAGCTGGCTGG + Intergenic
957040441 3:75331898-75331920 TGAGCATTGAGGAGGGTGGCTGG - Intergenic
957161065 3:76610360-76610382 TGAGGTTGCAGGATACGGGCAGG - Intronic
957334687 3:78811945-78811967 TGAGCTTGGGCGTGACTGACAGG - Intronic
958033746 3:88147063-88147085 TGAGCTTTGAAGGCACTGGCAGG - Intronic
961045226 3:123703460-123703482 TGAGCATTGAGGAGGGTGGCTGG - Intronic
961188780 3:124939823-124939845 TGATTTAGGAGGAGACTGGGGGG + Intronic
961306013 3:125959442-125959464 TGTCCTGGGAGGAAACTGGCGGG - Intergenic
961564540 3:127754223-127754245 TGAGCTTGGTGGGGAGTGGGCGG - Intronic
961677309 3:128575648-128575670 TGTGCTAGGAGGAGAAGGGCAGG + Intronic
961864613 3:129944658-129944680 TGAGCTAAGGGGAGAGTGGCGGG + Intergenic
962005061 3:131340548-131340570 TGAGTTTGGAGGAAATGGGCAGG + Intronic
962431884 3:135327708-135327730 GGAGCCTGGGGTAGACTGGCAGG - Intergenic
963011199 3:140772027-140772049 AGAGGGTGCAGGAGACTGGCAGG - Intergenic
963162812 3:142169243-142169265 AGAGCTTGGAGGAGCCTGAGTGG - Intronic
963782440 3:149500019-149500041 GGAGATTGGAGGGAACTGGCTGG - Intronic
964307547 3:155357206-155357228 TGACTTTGGAGGAGAAAGGCAGG - Intergenic
967457335 3:189703334-189703356 TGAGGCAGGAGGAGACTGGGAGG + Intronic
968042615 3:195600633-195600655 TATGGTTGGATGAGACTGGCTGG + Intergenic
970311088 4:14783274-14783296 TGAGATTAGAGGAGACTTTCAGG - Intergenic
972075452 4:35080310-35080332 TGAGCTGAGAGCAGACTGGTGGG + Intergenic
972729608 4:41781143-41781165 TGAGCTGAGGGGAGAATGGCAGG - Intergenic
975484477 4:74919408-74919430 CCAGCTTGGAGGAGAGGGGCAGG + Intergenic
975988614 4:80232634-80232656 TGAGCTTGCAGGGGACTTACAGG + Intergenic
976628060 4:87207921-87207943 TGAAGTTGGAGGAGACAGCCTGG - Intronic
977921500 4:102649044-102649066 TCAGCTTGGATGAGTCTTGCAGG - Intronic
978633853 4:110780281-110780303 TGAGCAAGGAGGAGACAGGTAGG - Intergenic
980038949 4:127916687-127916709 TGAGCTTGGAGGTGATTCACAGG + Intergenic
982540641 4:156665993-156666015 TGAGCTGGGAGGAGGGTGGGTGG - Intergenic
984641039 4:182164433-182164455 GGAGCTTGGACTAGAATGGCAGG - Intronic
985028482 4:185763390-185763412 GGTGATTGGAGGAGAATGGCTGG - Intronic
985190407 4:187366611-187366633 AGAGCTCAGAGGAGGCTGGCTGG - Intergenic
986676377 5:10189187-10189209 TGACCTGGGAGTAGACTGGGGGG - Intergenic
986738516 5:10684984-10685006 AGAGCTGGGAAGAGACAGGCTGG - Intronic
987355041 5:17056396-17056418 TGAGCCTTGAGGAAACTGACTGG - Intergenic
987722392 5:21654797-21654819 TGGGCTTGGAGAAGAATGTCAGG - Intergenic
989230067 5:39074765-39074787 AGAGCAAGCAGGAGACTGGCAGG - Intergenic
989793680 5:45439826-45439848 TGATATTGAAGGAGACTGGCAGG + Intronic
991146089 5:63306121-63306143 TAAGCTTGGAGGAGGCAGGTAGG + Intergenic
992201338 5:74387394-74387416 TTGACTTGGAGGAGACAGGCAGG - Intergenic
992475744 5:77100163-77100185 TAAGAATGGAGGAGGCTGGCAGG + Intergenic
993083476 5:83332851-83332873 AGAGCATGGAGGAGACAGGCAGG + Intronic
993152205 5:84174989-84175011 TAAGCTAGGTGGAGACTGCCAGG + Intronic
996811275 5:127518118-127518140 TGACTTTAGGGGAGACTGGCGGG + Intronic
997279368 5:132629425-132629447 GGAGCTTGGTGGAGCCTGGCGGG + Intronic
997658590 5:135573460-135573482 TGAGCTTGGGGTAGCATGGCTGG + Intronic
999239859 5:150121126-150121148 TGCTCTTGGAGGATGCTGGCTGG + Intronic
1000927137 5:167207621-167207643 TGATATTGGAGGAGAGTGCCTGG - Intergenic
1002129564 5:177071903-177071925 TAAGCTTGGGAGAGACAGGCCGG - Intronic
1003314211 6:4997237-4997259 TGTTTCTGGAGGAGACTGGCAGG + Intronic
1003505836 6:6739733-6739755 TGAGCTAGGAGGAGGCAGTCAGG + Intergenic
1004846226 6:19645505-19645527 TCAGTTTGGAGGAAACTGGTGGG + Intergenic
1004982565 6:21042480-21042502 TAAGCTTGGACGTGACTGGAAGG - Intronic
1005456192 6:26021827-26021849 TGATCTACGAGGAGACTCGCGGG + Exonic
1005839278 6:29730858-29730880 TGAGCTGGGCTGAGAATGGCGGG - Intronic
1005962540 6:30704283-30704305 TGAGCTTGGGGGTGACAGGCTGG + Exonic
1005962849 6:30705759-30705781 TGGGCTTGGGAGTGACTGGCTGG + Exonic
1006170283 6:32088160-32088182 TGGGCTTGGAGGGGAATGGGGGG - Intronic
1008686753 6:53933743-53933765 TTAGCTTGGATGAGAGTGGGAGG + Intronic
1009472576 6:64046446-64046468 TGAGCTGGGAGGACACATGCTGG + Intronic
1011745491 6:90403886-90403908 GGAGCTGGTAGGAGACTGGGAGG - Intergenic
1013318056 6:108960247-108960269 TGTGCTTGGCAGAGACTGGATGG - Intronic
1014272293 6:119348861-119348883 GCAGCTTGGAGGAGTCTGGCAGG + Exonic
1016317112 6:142802423-142802445 TGAGGGTGGCAGAGACTGGCTGG - Intronic
1017491642 6:154950676-154950698 TGAGGTTGGAGGGGACAGGGTGG + Intronic
1017607411 6:156148726-156148748 TGGGCTTGGTGGAGATGGGCAGG - Intergenic
1017615745 6:156244679-156244701 TGAGCTTGCATGAGACTGGAAGG + Intergenic
1020091558 7:5345015-5345037 TGAGCCTGGAGGAGTCAGGTGGG - Intronic
1022107677 7:27208550-27208572 TGAGCTGGGAGGGGACTTTCTGG + Intergenic
1022195192 7:28058470-28058492 TGAACTTGTAGGAGACTGGGGGG - Intronic
1025237022 7:57241414-57241436 TGACACTGGAGGAGATTGGCAGG + Intergenic
1026138271 7:67682661-67682683 TTAGGTTGGAGGAGAATGGATGG + Intergenic
1026513475 7:71046910-71046932 TGAGATTTGATGAGGCTGGCTGG - Intergenic
1027057705 7:75061406-75061428 TGAGCATGGAGCAGTCTGCCTGG - Intronic
1028748145 7:94350933-94350955 TGTGCTTGGAGAAGCCTTGCAGG - Intergenic
1029328087 7:99826935-99826957 TGAGCTTAGAGGACTCTTGCTGG + Intergenic
1029635630 7:101781824-101781846 TTAGATGGGAGGAAACTGGCCGG + Intergenic
1031401202 7:121328191-121328213 TGAGGTTGGGGGAGAAGGGCAGG + Intronic
1034089798 7:148353112-148353134 TGACCTTGGAGCAGGCTGCCGGG - Intronic
1034140514 7:148811229-148811251 TGAGCCTGGAAGAGCCTGGGAGG - Intronic
1034299047 7:149999100-149999122 GGATCTGGGAGCAGACTGGCTGG - Intergenic
1034806970 7:154097673-154097695 GGATCTGGGAGCAGACTGGCTGG + Intronic
1035601849 8:901931-901953 TGGGCAGGGAGGAAACTGGCTGG + Intergenic
1038395882 8:27245019-27245041 TGTGCTGGCTGGAGACTGGCAGG + Intronic
1039454267 8:37697210-37697232 TGAGTTTGGAGGAGGGCGGCGGG - Exonic
1041350879 8:56946770-56946792 TTAGATTGGAGGACACTAGCTGG + Intergenic
1045185615 8:99834654-99834676 TGAGGTGGGAGGAGGATGGCTGG - Intronic
1045572158 8:103379291-103379313 TCAGCCTGGAGTACACTGGCAGG + Intronic
1048867130 8:138769474-138769496 TTAGCTTGGAGGTGTCTGGGTGG - Intronic
1055370159 9:75589719-75589741 TGGGTGTGGAGGAGGCTGGCGGG + Intergenic
1056581219 9:87889070-87889092 TGGGCCTGGAGAAGGCTGGCAGG + Intergenic
1056826532 9:89879908-89879930 AGAGCTTGGATGTGAGTGGCCGG - Intergenic
1057930988 9:99192879-99192901 TGTGTTTGGAGGAAACTAGCAGG + Intergenic
1057966964 9:99513670-99513692 TGAGCTTGGACCACACTGACTGG + Intergenic
1058643079 9:107105880-107105902 AGAGCATGAAGGAGCCTGGCTGG + Intergenic
1058774993 9:108274242-108274264 TGGGATTGGAGGAGACTCTCTGG - Intergenic
1059759407 9:117324128-117324150 TGAGCTTGCATGAGTGTGGCTGG - Intronic
1060029265 9:120200221-120200243 TGAGCTTGGGGCAAACTGTCAGG - Intergenic
1060526150 9:124322426-124322448 TGGGCTGGGTGGAGGCTGGCAGG - Intronic
1061377542 9:130235208-130235230 TGAGCAGGGAGCCGACTGGCAGG - Exonic
1062100918 9:134728200-134728222 GGAGCTGGGAGGAGCCTGGCAGG - Intronic
1062192668 9:135255872-135255894 GGAGGTGGGAGGAGACAGGCTGG - Intergenic
1062344718 9:136109456-136109478 TGACCTGGGCGGAGACTGGAAGG - Intergenic
1186871645 X:13779950-13779972 TGTGCTTGGAGTGGCCTGGCTGG - Exonic
1187314093 X:18176034-18176056 TGAACATGGAAAAGACTGGCAGG - Exonic
1187468088 X:19543748-19543770 TGAAGGTGGAGGAGACTGGCGGG + Intronic
1187601647 X:20838660-20838682 TGAGCTTGGAAGAGTCAGACCGG + Intergenic
1188368302 X:29337044-29337066 TTGACTTGGAGGAGACTGGGGGG - Intronic
1188400725 X:29740692-29740714 CGACCTTGGAGTAGACTGGAAGG - Intronic
1189325496 X:40108740-40108762 TGAGCCAGGAGGAGCCCGGCCGG - Intronic
1189973019 X:46437040-46437062 TGAGCTTGGAGGAAAATTCCAGG - Intergenic
1191991785 X:67045855-67045877 TTTGCTTCAAGGAGACTGGCTGG + Intergenic
1193535412 X:82709550-82709572 TGAGCCTGGATCAGCCTGGCTGG - Intergenic
1195941204 X:110169391-110169413 TGAGGCTGGAGGAGAGTGGGGGG - Intronic
1198532715 X:137561577-137561599 TGAACTTGAAGGAGGCAGGCAGG - Intergenic