ID: 1175570837

View in Genome Browser
Species Human (GRCh38)
Location 20:60020378-60020400
Sequence TGCCCTACCCCAAGTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175570837_1175570841 -10 Left 1175570837 20:60020378-60020400 CCTCTCCCACTTGGGGTAGGGCA No data
Right 1175570841 20:60020391-60020413 GGGTAGGGCATGCAGTGGTTTGG 0: 1
1: 1
2: 3
3: 29
4: 198
1175570837_1175570844 6 Left 1175570837 20:60020378-60020400 CCTCTCCCACTTGGGGTAGGGCA No data
Right 1175570844 20:60020407-60020429 GGTTTGGCTGGCTTAAGAGTGGG 0: 1
1: 0
2: 3
3: 22
4: 107
1175570837_1175570842 -6 Left 1175570837 20:60020378-60020400 CCTCTCCCACTTGGGGTAGGGCA No data
Right 1175570842 20:60020395-60020417 AGGGCATGCAGTGGTTTGGCTGG 0: 1
1: 1
2: 5
3: 29
4: 197
1175570837_1175570845 16 Left 1175570837 20:60020378-60020400 CCTCTCCCACTTGGGGTAGGGCA No data
Right 1175570845 20:60020417-60020439 GCTTAAGAGTGGGTTCACCCTGG 0: 1
1: 2
2: 3
3: 15
4: 70
1175570837_1175570847 21 Left 1175570837 20:60020378-60020400 CCTCTCCCACTTGGGGTAGGGCA No data
Right 1175570847 20:60020422-60020444 AGAGTGGGTTCACCCTGGGCAGG 0: 2
1: 0
2: 4
3: 26
4: 185
1175570837_1175570846 17 Left 1175570837 20:60020378-60020400 CCTCTCCCACTTGGGGTAGGGCA No data
Right 1175570846 20:60020418-60020440 CTTAAGAGTGGGTTCACCCTGGG 0: 1
1: 1
2: 1
3: 11
4: 81
1175570837_1175570843 5 Left 1175570837 20:60020378-60020400 CCTCTCCCACTTGGGGTAGGGCA No data
Right 1175570843 20:60020406-60020428 TGGTTTGGCTGGCTTAAGAGTGG 0: 1
1: 0
2: 4
3: 17
4: 168
1175570837_1175570848 30 Left 1175570837 20:60020378-60020400 CCTCTCCCACTTGGGGTAGGGCA No data
Right 1175570848 20:60020431-60020453 TCACCCTGGGCAGGACTGCAAGG 0: 1
1: 1
2: 3
3: 28
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175570837 Original CRISPR TGCCCTACCCCAAGTGGGAG AGG (reversed) Intronic
No off target data available for this crispr