ID: 1175572304

View in Genome Browser
Species Human (GRCh38)
Location 20:60033213-60033235
Sequence AATAGTAACACCCCTCTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 1, 2: 3, 3: 8, 4: 122}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175572300_1175572304 6 Left 1175572300 20:60033184-60033206 CCTTATTGCTTTGTCGGTAAAAT 0: 1
1: 0
2: 0
3: 15
4: 139
Right 1175572304 20:60033213-60033235 AATAGTAACACCCCTCTTACAGG 0: 1
1: 1
2: 3
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175572304 Original CRISPR AATAGTAACACCCCTCTTAC AGG Intronic
909141897 1:71877510-71877532 AATAAGAACACCAGTCTTACTGG + Intronic
910088145 1:83428823-83428845 AATAGTAACACCCATCTTACAGG + Intergenic
910218053 1:84862491-84862513 AATAGTAGCACCTATCTCACAGG + Intronic
911770611 1:101736326-101736348 AATAATAACACTCCTCTCATGGG + Intergenic
912423776 1:109567641-109567663 AATAGTTACACCATTTTTACTGG + Intronic
913371036 1:118099974-118099996 AATAGTCACAGCCGTCTTACTGG - Intronic
913586855 1:120283616-120283638 AGTAATAACACCTATCTTACAGG + Intergenic
913621331 1:120614754-120614776 AGTAATAACACCTATCTTACAGG - Intergenic
915074013 1:153294236-153294258 AATACTAACACCCCCCTCAGAGG - Intergenic
916836453 1:168550698-168550720 AATAGCAACACCTTTCTTCCAGG + Intergenic
916949042 1:169760058-169760080 AATAATGACACCCCTTTTATGGG + Intronic
919427179 1:197447353-197447375 AATGGTAACATCCATCTTGCTGG - Intronic
919788694 1:201276309-201276331 ATTAGTAACAACCATCTCACAGG - Intergenic
920200093 1:204254651-204254673 AATAATAGCATCCATCTTACAGG + Intronic
920314641 1:205068710-205068732 AATAATAACACCCACCTCACAGG + Intronic
924191994 1:241562967-241562989 AGAAGTTACAACCCTCTTACTGG + Intronic
1062879990 10:970343-970365 AACACTAACACCCATCTTTCAGG + Intergenic
1063988376 10:11533028-11533050 AAAAGTAACATCCCTGTTAGAGG + Intronic
1065065109 10:21954789-21954811 AATAGTAGTACCTATCTTACAGG - Intronic
1067351433 10:45479829-45479851 TATAGCAGCACCCCACTTACTGG - Intronic
1070085179 10:73230153-73230175 ACAATTAACAGCCCTCTTACAGG - Intronic
1072475760 10:95758325-95758347 AACAGTAACATCTATCTTACAGG + Intronic
1073557882 10:104471128-104471150 AATAATAGCACCCATCTCACTGG + Intergenic
1075621944 10:123934485-123934507 TATAGGAACACCCATCATACTGG + Intronic
1079144504 11:17838681-17838703 AATAATAAAACCCCTCTCACAGG + Intronic
1079573998 11:21980350-21980372 AATATTAACACCTACCTTACGGG + Intergenic
1081160491 11:39742783-39742805 TATAGCACTACCCCTCTTACTGG - Intergenic
1090943906 11:131412781-131412803 AAAAGCAACTCCCTTCTTACGGG + Intronic
1091976323 12:4828730-4828752 AATCCTACCACCCCACTTACTGG - Intronic
1093439260 12:19174189-19174211 AATAGTACCATGCCCCTTACAGG - Intronic
1098458652 12:70706239-70706261 CATAGTACCAACCCTCTTTCTGG + Intronic
1098704488 12:73670982-73671004 TACAGTAACACCCCACTTCCAGG - Intergenic
1100580947 12:95939996-95940018 AATAATAACACCTTCCTTACAGG + Intronic
1101138464 12:101770399-101770421 AATAGTAACACACCAGGTACAGG - Exonic
1102869588 12:116403070-116403092 AATAATAACACCCATCTTACAGG + Intergenic
1103224837 12:119277888-119277910 AATAGTAACACCCACCTTTATGG - Intergenic
1107230556 13:38104607-38104629 ACTGGTAACAACCCTCTTAAGGG - Intergenic
1109856552 13:68136163-68136185 AATATTAACACCTATCTTATTGG - Intergenic
1110500113 13:76217514-76217536 AATAGTAACACCCATCTCATTGG + Intergenic
1117327230 14:54680791-54680813 AACAATAACAACACTCTTACTGG - Intronic
1117831361 14:59754578-59754600 AATAATAACCCCCACCTTACTGG + Intronic
1119615055 14:76093508-76093530 AATAATAATACCCCTTTTAAAGG + Intergenic
1125006447 15:34822867-34822889 AATAATAGTACCCATCTTACAGG + Intergenic
1128803201 15:70510255-70510277 AATAATAACATCCCTCTTGTAGG + Intergenic
1131028263 15:89163808-89163830 ATCAGTCACACCCCTTTTACAGG + Intronic
1134438455 16:14282889-14282911 AATTGTGACATCCCTCTTCCAGG + Intergenic
1140229093 16:73102787-73102809 AATAATAGTACCTCTCTTACAGG + Intergenic
1146111172 17:30091008-30091030 AATAGTGATACCCCACTTACAGG + Intronic
1148878935 17:50710486-50710508 AATAGTAGCACCCACCTTGCAGG + Intergenic
1150389612 17:64782625-64782647 AATAGTAACACCCACTTCACTGG + Intergenic
1150789836 17:68195281-68195303 GATAGTAACACCCACCTCACTGG - Intergenic
1155742296 18:29303648-29303670 TATTGCAACAGCCCTCTTACTGG + Intergenic
1156754503 18:40505320-40505342 AATACCAACACCCTTCTTCCAGG - Intergenic
1156856754 18:41791288-41791310 AATAATAAAATCCCCCTTACAGG + Intergenic
1159481915 18:69000278-69000300 AATAATAACACCCATCTCAAAGG - Intronic
1162613658 19:11777382-11777404 AATAGGAACACGCCTCTTGTTGG - Intronic
925035493 2:682132-682154 TAGAGTAACACCTCTCCTACAGG - Intergenic
926681797 2:15669695-15669717 AATAGCAACACCTTGCTTACCGG + Intergenic
927800946 2:26098979-26099001 GATAGTAACACCCGTCTCAATGG + Intronic
928524602 2:32126969-32126991 AAGAGTAACAGCCCTCTGGCAGG - Exonic
931101604 2:59008230-59008252 AATATAAACACCACTCTTAATGG - Intergenic
932888780 2:75571934-75571956 AATAATAATACTTCTCTTACAGG + Intergenic
933854302 2:86398328-86398350 AATAGCAACATCCTTCTTCCGGG - Intergenic
936249333 2:110855309-110855331 ATTAGTAACACCCATTTTAGGGG - Intronic
944179743 2:196877586-196877608 AATACTAAAACCTCTCTTAAAGG - Intronic
944468289 2:200025667-200025689 TATAGTAACACCCACCTTATAGG + Intergenic
944776566 2:202972818-202972840 TATAGTAAGCCCCCTCTTAAAGG + Intronic
945764067 2:213951403-213951425 AATAGTAACATATCTCTTAAAGG + Intronic
1172161170 20:32869219-32869241 AATTGCAACACCCATCTTGCTGG - Intronic
1172760173 20:37315955-37315977 AATAGCCACACCCGCCTTACAGG - Intronic
1173635442 20:44552668-44552690 GATAATAACAACCATCTTACAGG + Intronic
1175572304 20:60033213-60033235 AATAGTAACACCCCTCTTACAGG + Intronic
1182120200 22:27781501-27781523 AAGAGTAACACCCTTCCCACAGG - Intronic
951180736 3:19655277-19655299 AAAAGAAACACCCATTTTACTGG - Intergenic
954818434 3:53303244-53303266 AACAGTAACACCCCTTGGACAGG - Intronic
954956394 3:54523150-54523172 AATAATAACATCCCACTTAATGG - Intronic
956191897 3:66615865-66615887 AACAGTATCAACCCTCTTCCGGG + Intergenic
956451117 3:69375516-69375538 AATCGTAACTCACCTTTTACTGG - Intronic
957121259 3:76096723-76096745 AATAGCAACACCTATCTTGCTGG - Intronic
958878997 3:99648130-99648152 AATAATAACACCCTTCTTGTAGG - Intronic
962744854 3:138389655-138389677 AATAGGAACACCCTTCTTCCTGG + Intronic
965168679 3:165231332-165231354 ACTAGTAACACCTATCTCACAGG - Intergenic
965985140 3:174743765-174743787 AATAATAATAACCATCTTACAGG + Intronic
967125242 3:186417616-186417638 GATAGTAACACCTCCCTCACAGG - Intergenic
967428875 3:189358753-189358775 AATTGTTACACCCCACTTAAGGG - Intergenic
967512645 3:190329849-190329871 AATACTAACATCCTTCTAACTGG - Intronic
970307482 4:14748662-14748684 AATAACAACACCCACCTTACAGG + Intergenic
971817609 4:31508810-31508832 AAAAAAAACACACCTCTTACTGG - Intergenic
974194176 4:58550077-58550099 ATTATTAACTCCCTTCTTACTGG - Intergenic
975669439 4:76766153-76766175 AATAATAATACCTCTCTCACCGG + Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
976450542 4:85185512-85185534 AATAGTAATAACCTCCTTACTGG + Intergenic
976747314 4:88416296-88416318 AATAGCAAAACCGCTCTCACAGG - Intronic
977011257 4:91636545-91636567 AATGATAACACCTCTCTCACAGG - Intergenic
978865362 4:113502291-113502313 AGTAGTTAAACCCCTGTTACTGG + Intronic
986071027 5:4282947-4282969 AATAGCAACACCTTTCTCACAGG + Intergenic
988862832 5:35302484-35302506 AACAGAAACACCCCTCTTTAGGG - Intergenic
989264715 5:39459551-39459573 AATAGTAACACATTTCTTATGGG + Intronic
992891108 5:81205182-81205204 ACTAGTAGCAGCCCTCTTATCGG - Intronic
993180500 5:84546495-84546517 AATAATAACACCATTTTTACTGG - Intergenic
996000383 5:118354792-118354814 AATAGTAACACTGCTCTTACAGG + Intergenic
998507068 5:142680566-142680588 AATAGTAATACCTCACTTATGGG + Intronic
1007182284 6:39938133-39938155 AATCATAACAGCCATCTTACAGG - Intergenic
1009886536 6:69630076-69630098 AATAATAACACCTTACTTACAGG + Intergenic
1010455211 6:76046692-76046714 AATAATAATACCTCCCTTACAGG + Intronic
1012366890 6:98452097-98452119 AATAGTAACACCCACCTTGCAGG - Intergenic
1014226210 6:118850452-118850474 AAAAATAACACCCTTCTTACAGG - Intronic
1022228642 7:28391247-28391269 AATAATCACACCTCTCTTAACGG + Intronic
1024663730 7:51524082-51524104 AATAATAATACCCCTCTCATAGG - Intergenic
1027305018 7:76885260-76885282 AATAGTAACATCCATCTTACAGG + Intergenic
1027352485 7:77326247-77326269 AAGATTAACACCCCTCCTGCAGG - Exonic
1027414491 7:77960569-77960591 AACAGTAATACCTATCTTACAGG + Intergenic
1031882437 7:127212071-127212093 AATAGTCACACCCCTATTTTTGG + Intronic
1031882613 7:127214172-127214194 AATAGTCACACCCCTATTTTTGG + Intronic
1035402341 7:158575405-158575427 AAAAGTAAAACCCATCTTATGGG - Intronic
1036678055 8:10851294-10851316 AATAGTACCACCCCCCTCACAGG - Intergenic
1039966473 8:42287675-42287697 AATACTGACACCCATCTTTCAGG - Intronic
1042566022 8:70112954-70112976 AATGTTAACAGCCCTCTCACAGG + Exonic
1043721832 8:83554338-83554360 AATAGAAACAGAACTCTTACAGG - Intergenic
1046088110 8:109464325-109464347 AATAGTAACAGCTCTGTTATAGG - Exonic
1046870643 8:119202295-119202317 AATAGTAACAGACTTCTTATAGG - Intronic
1048601361 8:135922119-135922141 AATAGTAACACCTGCTTTACAGG - Intergenic
1050940873 9:11455142-11455164 AGTAGTAAGACCCCTCTTTGAGG + Intergenic
1052036597 9:23688399-23688421 AATATTTACACCACTATTACAGG - Intergenic
1053456331 9:38235703-38235725 AATAGAAACAGCCTTCTTGCTGG - Intergenic
1054967853 9:71050022-71050044 AATAATAACAACCTTCTTGCAGG + Intronic
1055326614 9:75136939-75136961 AACAGTAAGACCCCTCTCTCAGG - Intronic
1056045865 9:82715202-82715224 AATAATAACACTCCTATTAATGG - Intergenic
1058725680 9:107801676-107801698 AATAATAATGCCCATCTTACAGG - Intergenic
1187176852 X:16903728-16903750 AATAGTATCACCCTGCTTCCTGG - Intergenic
1187274319 X:17805036-17805058 AATTGTAAGACCCCTCTGGCTGG - Intronic
1192141203 X:68648250-68648272 CATAGTAACACCAACCTTACGGG + Intronic
1195621938 X:106965569-106965591 TATAGTAGTACCCCTCTTCCAGG - Intronic
1198897136 X:141468120-141468142 AATAATAATACCTCTCTCACAGG + Intergenic
1199581479 X:149364910-149364932 AATGGTAATACCACTCTCACAGG - Intergenic