ID: 1175572393

View in Genome Browser
Species Human (GRCh38)
Location 20:60033952-60033974
Sequence TTCTATGAGAATTTATAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175572393 Original CRISPR TTCTATGAGAATTTATAGAA GGG (reversed) Intronic
906001626 1:42431288-42431310 TTCAATAACAATTTATAGGAAGG - Intronic
906907650 1:49913147-49913169 TTCTATGAGACTTTAGACCATGG - Intronic
907668778 1:56456450-56456472 TTAAATGAGAAAATATAGAAAGG - Intergenic
908778960 1:67670783-67670805 TGCTATGAGAGTTTATAGCAGGG - Intergenic
909353049 1:74676040-74676062 TTCTATGTTAATTTCTAGAATGG + Intergenic
909564707 1:77041492-77041514 TTCCATGATAATTTATTCAATGG - Intronic
911452881 1:98087390-98087412 TCCTATGAAAATTTGTGGAAAGG + Intergenic
911771951 1:101754879-101754901 TTCTATAAGAATTTTCAGTAAGG - Intergenic
912011831 1:104976291-104976313 TTCTATTAGAATGTGAAGAAAGG + Intergenic
912064183 1:105715407-105715429 TGCTAAGGGAATTTATAGACGGG - Intergenic
912181930 1:107229533-107229555 TTAAATGAGAATTTATGGAAAGG + Intronic
913032569 1:114924461-114924483 TACTATTAGAGTCTATAGAAAGG + Intronic
913426846 1:118740999-118741021 TTCTATGAGAATGCATAAAATGG + Intergenic
915921556 1:159979823-159979845 TGCTGTGAGAGTTTAAAGAAGGG + Intergenic
916795532 1:168163622-168163644 TGCTATGAGAATACAGAGAAAGG - Intergenic
916870665 1:168911322-168911344 TTCAATAAGTATTTATAGAATGG - Intergenic
916930548 1:169574129-169574151 TACTATGAAATTTTATATAAGGG + Intronic
917323394 1:173807430-173807452 CTATAGGAGAATTTATATAAGGG + Exonic
917528516 1:175811362-175811384 TTATAGGAGTATTTATAGTAGGG - Intergenic
917622108 1:176807222-176807244 TTCTATGAGAATTAATAGTGGGG - Intronic
917771230 1:178281136-178281158 TTTTATGAGAATGTATACCAAGG - Intronic
919128223 1:193422522-193422544 TTATAACAGAATTTATAGAGGGG - Intergenic
919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG + Intergenic
920741595 1:208586278-208586300 TTCTATCAAAACTAATAGAATGG + Intergenic
920894570 1:210032832-210032854 TTCTATCACAATTAGTAGAATGG - Intronic
921436406 1:215128559-215128581 TGCTATGAGAATTGAGAAAAAGG + Intronic
922818114 1:228465449-228465471 TTCATTGGGAATTAATAGAATGG - Intergenic
923998300 1:239521917-239521939 TTCTATGACATTTCATATAAGGG + Intronic
924181289 1:241440862-241440884 TTCTACGAAAATTTATAGAATGG + Intergenic
924699640 1:246438577-246438599 TACTATGCCATTTTATAGAAGGG - Intronic
1063778661 10:9294771-9294793 TTCTATGAGAATTAAAAAAAGGG - Intergenic
1064202563 10:13297343-13297365 TTGTATGAGAATATTTAGGAAGG + Intronic
1064287667 10:14006090-14006112 TTCTGTGACAATTTTCAGAATGG - Intronic
1065396433 10:25243615-25243637 TGCTATGAGAACTTATATTAAGG - Intronic
1065414993 10:25474532-25474554 TTCCATGAGAAGTTATTGCAAGG - Intronic
1065987542 10:30970655-30970677 TTTTATGGGAATTGGTAGAAAGG - Intronic
1066771764 10:38851987-38852009 TTTTATGGAAATATATAGAATGG + Intergenic
1068165788 10:53330866-53330888 TGCTGTGAGAATTCACAGAAAGG + Intergenic
1068455997 10:57254792-57254814 TTCTATGGCATTTTATATAAGGG - Intergenic
1068554418 10:58442672-58442694 TTCTATAATTATTTATTGAAAGG + Intergenic
1069262602 10:66416790-66416812 TTCTTTGAGTATTTATTGTATGG - Intronic
1071419719 10:85480075-85480097 TTCTGTGTGAATTCAAAGAAAGG + Intergenic
1072996581 10:100250051-100250073 TTGTAGGAGAGTTTAAAGAAGGG - Intronic
1074151804 10:110766210-110766232 TTCTAAGAAAATATCTAGAATGG + Intronic
1075535975 10:123272592-123272614 TTCTATGGAAATTTCTGGAAAGG + Intergenic
1078141315 11:8695180-8695202 TACTATGCCATTTTATAGAAGGG + Intronic
1079762353 11:24345187-24345209 TAATATGAACATTTATAGAAAGG - Intergenic
1080066330 11:28019398-28019420 TTCTATAAAAATTAATAAAAGGG - Intergenic
1080320738 11:31006354-31006376 CTCTATGGGAATCTATAGGAAGG - Intronic
1080847898 11:36042417-36042439 TTCTTTGAGAAATGACAGAACGG - Intronic
1081082904 11:38765772-38765794 TTCTATGATAAGTTACAGGAAGG - Intergenic
1081347616 11:42009874-42009896 TCTTATGAGACTTTATAGACTGG + Intergenic
1081378979 11:42391929-42391951 TACATTGAGAATTTATAGGAAGG - Intergenic
1082633570 11:55568636-55568658 TCCTTTGAGAATTTGTTGAAAGG + Intergenic
1086996335 11:93360303-93360325 TCCTCTGACAATTTCTAGAAGGG - Intronic
1087409484 11:97773849-97773871 TTCTCTTAGAATTCAAAGAAAGG + Intergenic
1087624784 11:100584115-100584137 TTCTAGAAGACTTTATATAATGG - Intergenic
1087675918 11:101161305-101161327 TTTGATGAGAATTTTTATAAAGG + Intergenic
1088202446 11:107353483-107353505 TTCTATGAGAATGTAAGCAAAGG + Intronic
1089721577 11:120428714-120428736 TTCTATGAGGATTCAAAGGAGGG + Intronic
1089892466 11:121895095-121895117 TGCTGTGGGAATTTAGAGAAGGG + Intergenic
1092929128 12:13298601-13298623 TTTTATGAGACTGTATAGCAAGG - Intergenic
1095578558 12:43767814-43767836 TCCTAGTAAAATTTATAGAAAGG - Intronic
1096510795 12:52126956-52126978 TTTTATGAGAATGTATTGTAAGG + Intergenic
1097446888 12:59682556-59682578 TTAATTGAGAATTTAGAGAAGGG + Intronic
1098311276 12:69151523-69151545 TTCAATAAAAATTTATTGAATGG - Intergenic
1098451480 12:70622935-70622957 TTCTATGAGAATTTAGGGGGGGG + Intronic
1099593902 12:84632438-84632460 ATTTAGGAGAAATTATAGAAAGG + Intergenic
1099983162 12:89630361-89630383 TTCTATTAGACTTAATAGCATGG - Intronic
1100138140 12:91581050-91581072 TTTTATGTGCATTTATAAAATGG + Intergenic
1100193913 12:92222470-92222492 TGCTATGAGAATTTGTAAAAGGG + Intergenic
1101571322 12:105956567-105956589 TTCCATGAAAATTCAAAGAAAGG + Intergenic
1101850350 12:108396990-108397012 ATCAATGAGAATGTTTAGAATGG + Intergenic
1102018515 12:109664629-109664651 TTATAGGACAATTTATAGCATGG + Intergenic
1102853329 12:116271818-116271840 TTTTATGAGAATTAGTAGTATGG - Intronic
1102874572 12:116439726-116439748 TGCTATGAGAATTCATGAAATGG - Intergenic
1104134596 12:125924967-125924989 TGCTATGAAAATTTATACACAGG + Intergenic
1104176668 12:126339809-126339831 TTCTTAGAGAAGTTATAGACAGG - Intergenic
1105336401 13:19473913-19473935 TTCTTCGAGTATTTGTAGAAGGG - Exonic
1107218870 13:37955596-37955618 TGCTATGAGAATCTATGGATGGG - Intergenic
1107489191 13:40864191-40864213 TTCTTCGAGTATTTGTAGAAGGG - Intergenic
1108009273 13:45987437-45987459 TCTTATTAAAATTTATAGAAAGG + Intronic
1108413639 13:50175594-50175616 GACTCTGAGAATTTTTAGAATGG + Intronic
1108631699 13:52289821-52289843 TTCTTCGAGTATTTGTAGAAGGG - Intergenic
1108654991 13:52522774-52522796 TTCTTCGAGTATTTGTAGAAGGG + Intergenic
1109099828 13:58168131-58168153 TTCTCTGACAAATTATAGGAAGG + Intergenic
1109183478 13:59242589-59242611 GTGTATGAGGATTGATAGAATGG - Intergenic
1109342828 13:61083808-61083830 TTCTAAAAGAATCTATAGACTGG + Intergenic
1109643989 13:65228396-65228418 TTAAATGAGAATTTCTAAAAGGG - Intergenic
1110053600 13:70936558-70936580 TTCAATGAGTATTTCTAGGAAGG - Intergenic
1110588321 13:77221872-77221894 TACTATGCCAATTTATATAAGGG - Intronic
1111036004 13:82675980-82676002 ATGTATGAGAACTTATAAAATGG - Intergenic
1111316902 13:86575269-86575291 TTTTATTAGTATTTATAGCATGG - Intergenic
1111720415 13:91936731-91936753 TTCTAAGAAAATAGATAGAAAGG + Intronic
1111819630 13:93196640-93196662 TTTAATGAGAATGTATAAAATGG - Intergenic
1112173961 13:97002930-97002952 GTCTATGAAAATTCAAAGAAAGG - Intergenic
1112202502 13:97290747-97290769 TACTATGAGAATTACTAGAAAGG + Intronic
1112548525 13:100396361-100396383 TTAAATGAGATTTTATATAAAGG + Intronic
1113352552 13:109543496-109543518 TACTATGAGATTTTATATCAGGG - Intergenic
1113549148 13:111178420-111178442 TTCTGTGATAGTTTAGAGAAAGG + Intronic
1114959235 14:27863268-27863290 GTCTATGAGAAATAAAAGAATGG - Intergenic
1114995990 14:28352583-28352605 TTCTAGCAGTATTTTTAGAATGG + Intergenic
1115195166 14:30790773-30790795 TTCTATGTGAATTTTTTGTATGG - Intergenic
1115601163 14:34957113-34957135 TGCTGTGAGTTTTTATAGAATGG + Intergenic
1116896331 14:50318788-50318810 TACCATGAGAATCTAGAGAAGGG - Intronic
1117024006 14:51601292-51601314 TTCTATGAGACCTCAGAGAAGGG + Intronic
1117174386 14:53132047-53132069 TCCTTTGTGAATTTATATAATGG - Intronic
1119077447 14:71656446-71656468 TTCTATACATATTTATAGAAAGG + Intronic
1119416348 14:74472637-74472659 TGCTATGAAAATGTATAGCAAGG + Intergenic
1121070933 14:91020439-91020461 TACTATGCCAATTTATATAAGGG + Intronic
1202905681 14_GL000194v1_random:70803-70825 TTCTATTATTTTTTATAGAAGGG - Intergenic
1124514966 15:30360006-30360028 TTCTAAGGGCATTTCTAGAAAGG - Intergenic
1124727956 15:32170756-32170778 TTCTAAGGGCATTTCTAGAAAGG + Intronic
1124932224 15:34131778-34131800 TTCTAGGAGAAAATAAAGAAGGG - Intergenic
1125408606 15:39381164-39381186 TTCCAGGAGCATTTATTGAATGG - Intergenic
1126419183 15:48453548-48453570 TTCTATGAATAGTTATGGAATGG + Intronic
1127613641 15:60661584-60661606 TTCAAAGAGAATTAATAGATGGG - Intronic
1127706170 15:61549130-61549152 TTCTATCAGACTTTAGAGATTGG + Intergenic
1128399489 15:67263330-67263352 CTCTACTAGAATTAATAGAAAGG - Intronic
1128411425 15:67402706-67402728 TTCTGGGAGAATTATTAGAAAGG + Intronic
1129645884 15:77432129-77432151 TTCTCTGAGAATATATCCAAGGG - Intronic
1130446847 15:84010298-84010320 ATCTATGGTAATTTAGAGAAGGG - Intronic
1130719112 15:86369195-86369217 TTTTATGAGAAATTACAGAAAGG + Intronic
1132914611 16:2336784-2336806 TTCAATGAGAGTTTATAAATGGG + Intronic
1133124354 16:3635756-3635778 TTCTTTGAGAAATTATTCAAGGG - Intronic
1137230789 16:46565240-46565262 TTCTATTTAGATTTATAGAATGG + Intergenic
1138234112 16:55365837-55365859 TTCTGTAAGAATTTAGAAAATGG - Intergenic
1138325940 16:56168036-56168058 GTCTATGAGAATTAACAAAAGGG + Intergenic
1138854764 16:60676829-60676851 TGCAATCAGCATTTATAGAATGG + Intergenic
1139933324 16:70547903-70547925 TTCTATGAGTGCTTATAGAAGGG + Intronic
1140322888 16:73970881-73970903 TTTGATGTGAATTTCTAGAATGG - Intergenic
1142202278 16:88766910-88766932 TTCTCTGAGATTTCATGGAAAGG - Intronic
1145276936 17:21437175-21437197 TTCTAAGAGAACTCATAGATGGG + Intergenic
1145314767 17:21723068-21723090 TTCTAAGAGAACTCATAGATGGG + Intergenic
1145713209 17:26995005-26995027 TTCTAAGAGAACTCATAGATTGG + Intergenic
1148604874 17:48921644-48921666 TTCTAGGAGAATTTTGAGTAAGG + Intronic
1149824360 17:59813831-59813853 TTTTACTATAATTTATAGAAAGG - Intronic
1149938369 17:60833166-60833188 TTCTTTTAGAATATATAAAATGG - Intronic
1150169339 17:62976208-62976230 TGATTTGAGATTTTATAGAAAGG - Intergenic
1155783471 18:29870145-29870167 TTAAATGAGGATTTATAGAATGG + Intergenic
1156174691 18:34530021-34530043 TTCTATGAGATTATATACAAAGG + Intronic
1156422148 18:36966243-36966265 TTCTATTAGTATTTATTGTAAGG - Intronic
1156853252 18:41753016-41753038 TTCTCAGAGAATTTATGGAATGG - Intergenic
1156882676 18:42099679-42099701 TTCCATAAGATTTTATAAAATGG + Intergenic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1168232842 19:55044376-55044398 TACCATGAGAATTGATAGGAAGG + Exonic
925808449 2:7675036-7675058 TTCTATGTGGAGTTTTAGAATGG - Intergenic
925826504 2:7853250-7853272 TTCCATGAAAATTGATAGAGAGG - Intergenic
926227394 2:10978130-10978152 TTTTATCAGAACTTATGGAAAGG + Intergenic
927468457 2:23354281-23354303 TTCAATGAGAAGTTTTGGAAAGG + Intergenic
928659478 2:33486646-33486668 TTCTGTGGGAATTCAGAGAAAGG + Intronic
929487545 2:42368323-42368345 ATCTCTGTGAATTTAAAGAATGG + Intronic
930718717 2:54618326-54618348 TTTTTTGAGGATTTATGGAAAGG + Intronic
931597212 2:63960929-63960951 TTCTTTGAGAATCCATTGAAAGG - Intronic
932098423 2:68873398-68873420 TTCTATGGTAATTTAAAAAATGG - Intergenic
932378230 2:71257433-71257455 TTCTAAGAAAATTATTAGAAAGG + Intergenic
933345396 2:81078648-81078670 TTCTATGACAAATTTTAAAAAGG + Intergenic
933415745 2:81984973-81984995 TTACATGAGAATTTCTAGAATGG - Intergenic
934500925 2:94859673-94859695 TTCTATTATTTTTTATAGAAGGG + Intergenic
936833221 2:116674813-116674835 TTTTATCAGAATTTTTAAAAAGG - Intergenic
937545374 2:123011219-123011241 TTCTTTGAGAATTTTTAAGATGG - Intergenic
937729701 2:125213895-125213917 TTCTTGGAGCATTTATATAACGG + Intergenic
938657485 2:133448924-133448946 ATCTATGTTATTTTATAGAAAGG - Intronic
939910798 2:147980372-147980394 TACCATGCCAATTTATAGAAAGG + Intronic
941440590 2:165530093-165530115 ATCTATGAGGATTTATAAAAGGG + Intronic
941515377 2:166468222-166468244 ATCTATCATGATTTATAGAAAGG + Intronic
942163794 2:173220994-173221016 TTATGTGAGAATTTATTTAATGG - Intronic
942188775 2:173449945-173449967 GTGTATGATAATTTATATAATGG + Intergenic
942720303 2:178944241-178944263 TTTTATGATAATTTAGATAATGG + Intronic
942738254 2:179141138-179141160 TTCTAAGAGAATATGTAGAAGGG - Intronic
943013437 2:182480684-182480706 TACTATGACACTTTATATAACGG + Intronic
943521156 2:188950432-188950454 TTCTATGCCATTTTATATAAGGG + Intergenic
943624695 2:190185499-190185521 TTCTGTGAGGATTTATATTATGG + Intronic
944032770 2:195257362-195257384 TTCTATGAGGATTTATAAAATGG + Intergenic
944586028 2:201174714-201174736 TTATATGAAAATTTAGGGAAAGG - Exonic
944900383 2:204207841-204207863 CCCTATGAGAATTTTTGGAAAGG - Intergenic
945499970 2:210559939-210559961 TTCTACTAAAATGTATAGAATGG - Intronic
945664402 2:212722719-212722741 TTCTATGAAAATATAGACAAGGG + Intergenic
945665951 2:212742608-212742630 TTCTATAACAATATATGGAACGG + Intergenic
945685880 2:212969653-212969675 ATCTTTGAGAAATTAAAGAAAGG - Intergenic
945987167 2:216364279-216364301 CTCTATGAGTATTTCTTGAAAGG - Intronic
946510688 2:220352720-220352742 TACTTTGAGAATTTAGACAAAGG - Intergenic
946714981 2:222544480-222544502 TACTATGATATTTTATATAAGGG - Intronic
946911535 2:224466511-224466533 TTCTAAGAGAGGTTGTAGAAGGG + Intergenic
947612860 2:231534312-231534334 GACTATGAGAATTTATAAATGGG - Intergenic
947766195 2:232639196-232639218 TTTTATGAGAATTTGAATAATGG + Intronic
948137263 2:235645787-235645809 TTAAATCAGAATTTATAGGAAGG + Intronic
948589486 2:239040027-239040049 TTCTAAGATAAATTTTAGAAAGG - Intergenic
1169670813 20:8099731-8099753 ATCTATTAGAATTTTTAAAATGG + Intergenic
1169750319 20:8985848-8985870 TTCTATGCCATTTTATATAAGGG - Intergenic
1170098954 20:12677511-12677533 TTGTATCAGAATTTATAAACAGG - Intergenic
1171892146 20:30726428-30726450 TTCTATTATTTTTTATAGAAGGG + Intergenic
1172437990 20:34943665-34943687 TTCTATGAGAACACATAGTAGGG - Intronic
1173096228 20:40031257-40031279 TTTTATTAGAATTCTTAGAATGG - Intergenic
1174711709 20:52713306-52713328 TTCTATGATCATTTATTGATAGG + Intergenic
1175572393 20:60033952-60033974 TTCTATGAGAATTTATAGAAGGG - Intronic
1176334615 21:5584326-5584348 TTCTTTGAGAATGCAAAGAATGG - Intergenic
1176393142 21:6236622-6236644 TTCTTTGAGAATGCAAAGAATGG + Intergenic
1176468277 21:7079552-7079574 TTCTTTGAGAATGCAAAGAATGG - Intronic
1176491838 21:7461330-7461352 TTCTTTGAGAATGCAAAGAATGG - Intergenic
1176508804 21:7677053-7677075 TTCTTTGAGAATGCAAAGAATGG + Intergenic
1176625039 21:9085558-9085580 TTCTATTATTTTTTATAGAAGGG - Intergenic
1176737151 21:10561170-10561192 TTCTTCGAGTATTTGTAGAAAGG + Exonic
1176911282 21:14568054-14568076 CTCAATCAGAATTTCTAGAATGG - Intronic
1176980147 21:15372363-15372385 TTATATGATAATTGATATAATGG + Intergenic
1177233633 21:18356586-18356608 ATCTTTGAGAATTTCTGGAAGGG + Intronic
1177320816 21:19517918-19517940 TACTATAGTAATTTATAGAAGGG + Intergenic
1178674529 21:34619982-34620004 TTCAAAGAGAACTTAGAGAAAGG - Intergenic
1180563152 22:16638719-16638741 TTCTTCGAGTATTTGTAGAAGGG + Intergenic
1181773494 22:25143530-25143552 GCCCATGACAATTTATAGAAAGG - Intronic
1182811130 22:33117616-33117638 TTCTAGGAGAGTTTATAGACAGG + Intergenic
1183531974 22:38361398-38361420 TTCTTCGAGTATTTGTAGAAGGG - Intronic
949460957 3:4293486-4293508 TTCTATGACCATTTATAAATTGG + Intronic
950270844 3:11613725-11613747 ATCAATGAGAATTCATATAAAGG + Intronic
950833293 3:15896217-15896239 TTCAATTTGAATTAATAGAATGG + Intergenic
951922799 3:27874572-27874594 TTCTATGTGCATTTTTAAAAGGG + Intergenic
952068516 3:29602964-29602986 TTCTATGAGAACAGATAAAAAGG - Intronic
952314560 3:32221322-32221344 ATCTATGAGATTTAATAAAATGG + Intergenic
952441197 3:33331152-33331174 TTTTATGACAATTAATAGTATGG - Intronic
954052152 3:47988694-47988716 TTCTATTTGAATTTAAAAAATGG + Intronic
954161547 3:48726439-48726461 TTCTTTGTGAGTTTATATAATGG + Intronic
956580909 3:70812221-70812243 TTCTTTGAGAAGTTTTAAAAGGG + Intergenic
957853188 3:85838193-85838215 ATCTATGTGAATTTAAACAAGGG + Intronic
957926147 3:86814546-86814568 TTCTTTGACAATTTATAAAATGG - Intergenic
958679929 3:97315888-97315910 TTCTATACAAACTTATAGAAAGG - Intronic
960305345 3:116053538-116053560 TTGAATGAAAATGTATAGAAGGG + Intronic
960998508 3:123355489-123355511 TACTATGACATTTTATATAAGGG + Intronic
961133943 3:124493218-124493240 TTCTATAAGAATTCAAAGAAAGG + Intronic
962058741 3:131902847-131902869 GTCAATGAGAATATTTAGAAGGG + Intronic
962464047 3:135640248-135640270 TTCTCTGAGAATCTCTAAAATGG - Intergenic
963543144 3:146620533-146620555 TTCTGTGATATTTTATATAAAGG + Intergenic
964471237 3:157058399-157058421 TTCTATGCCATTTTATATAAGGG + Intergenic
964738924 3:159944935-159944957 TTCTATGAGGAACTATAGATTGG + Intergenic
965065634 3:163844006-163844028 TTATCTGAGAAATTATGGAATGG + Intergenic
965663221 3:171064304-171064326 TTCTTTGTTAATTTCTAGAAAGG + Intronic
966171635 3:177088083-177088105 TACACTGAGAATTTATAGAAAGG + Intronic
967368180 3:188711807-188711829 TTCTTTGAGAATTCAGAAAAAGG + Intronic
968068489 3:195771976-195771998 TTCTGTGAGAATATATGGAAAGG - Intronic
970289286 4:14554029-14554051 TTACCTGAGGATTTATAGAAAGG - Intergenic
971491947 4:27222589-27222611 TTCTCTCAGTCTTTATAGAATGG + Intergenic
971528083 4:27647576-27647598 TTCTTGAAGAATTTATAGACTGG + Intergenic
971765502 4:30825625-30825647 TTCTTTGAGCTTTTATGGAAAGG - Intronic
971866982 4:32185012-32185034 TACTATAAGAATTTAGATAAGGG + Intergenic
975015965 4:69419938-69419960 TTCTATAATATTTTATAGTATGG + Intronic
975775481 4:77782085-77782107 TTATATGAGAATGTGTAAAATGG - Intronic
976324433 4:83754896-83754918 TTCCTTGAGGATATATAGAAGGG + Intergenic
977757925 4:100695576-100695598 TTTTATGACAATTAATAAAAGGG - Intronic
977829435 4:101572719-101572741 TCCTATTAGAATTCATGGAAAGG + Intronic
979911366 4:126370757-126370779 TTCCTAGTGAATTTATAGAACGG + Intergenic
980028342 4:127793616-127793638 TTATGTGAGAATTAAGAGAATGG - Intronic
980642711 4:135600415-135600437 TTCTATGAGGTTTTATCAAAAGG + Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
982268777 4:153565420-153565442 TTATTTTAGAAATTATAGAATGG + Intronic
982300954 4:153879099-153879121 TTTTATAAGAAGTTATAAAATGG - Intergenic
982490379 4:156022399-156022421 TGCTATAAGAAATTTTAGAAGGG + Intergenic
983127391 4:163971040-163971062 TTCTATGAATATTTACAGCAGGG + Intronic
983309996 4:166047621-166047643 TTCTATGTGAATTTATGTCATGG + Intronic
983591900 4:169422587-169422609 TTATATAAATATTTATAGAACGG + Intronic
983618391 4:169733402-169733424 TTCTTTGAGAATGAAAAGAATGG + Intronic
983845978 4:172518470-172518492 TTTTTTTAGAATTTAGAGAACGG + Intronic
984057182 4:174943885-174943907 TTTTATGAGAAATTATTCAATGG + Intronic
984288666 4:177765237-177765259 TTCTATATGGAATTATAGAATGG + Intronic
984419527 4:179502355-179502377 TTAAAAGACAATTTATAGAATGG - Intergenic
985214369 4:187635166-187635188 TACTTGGAGAATTTAAAGAATGG - Intergenic
985229069 4:187795761-187795783 TTCTGGGAGGATTTATGGAAAGG - Intergenic
987181332 5:15371740-15371762 TGCTATGGGAATTTAAAGGAGGG - Intergenic
987518763 5:18951223-18951245 TTTTATGAAAATTAACAGAATGG - Intergenic
987959382 5:24785831-24785853 ATCTATAAGAATTTATAATAGGG + Intergenic
989183379 5:38599940-38599962 TTCTATCAGTATTTCTAAAAGGG - Intronic
989323510 5:40164596-40164618 TTTTATGATAACCTATAGAAAGG - Intergenic
990086943 5:51990263-51990285 CTCAATGAGAATGTAAAGAAAGG - Intergenic
990090571 5:52041777-52041799 TTTTATCAGGATTTATAGAAAGG - Intronic
990846793 5:60149736-60149758 TGCTATGAGAATGCATAGGAAGG - Intronic
992370326 5:76137218-76137240 TGCTATAATAATTAATAGAAGGG + Intronic
992460048 5:76952609-76952631 TTCTTTGACAATTTCTAGCATGG + Intergenic
992620419 5:78586819-78586841 TTATTTGAGAAGTTCTAGAAAGG + Intronic
992697509 5:79304773-79304795 TTTTTTGATAATTTAGAGAATGG - Intronic
993085586 5:83359441-83359463 TTCTCTGGTAATTTATAGATTGG - Intergenic
993321109 5:86468187-86468209 TTATATGAGAATATATATATGGG - Intergenic
994289497 5:98011729-98011751 TTCTTTGAGAATTTTTTAAAAGG - Intergenic
994361807 5:98860067-98860089 TTCTAGAAGAATTTAAAAAAAGG + Exonic
994551858 5:101244209-101244231 TTGTATGAGAAGTGATATAAGGG - Intergenic
994760567 5:103847468-103847490 TTCTATGAGATTTTAAAAAATGG - Intergenic
996072276 5:119146094-119146116 TGCTATGCAAATTTATAAAAGGG + Intronic
996253042 5:121361288-121361310 TTTTATAAATATTTATAGAAGGG - Intergenic
996304870 5:122035606-122035628 TTCTATTAGAATTTTTAGAGTGG + Intronic
997636932 5:135417293-135417315 TTTTCTGAGAATTTTTATAATGG + Intergenic
999339011 5:150751912-150751934 TTGTGTAAGAATCTATAGAAAGG + Intronic
999998796 5:157118094-157118116 ATCTATGAGAATGTGCAGAATGG - Intronic
1000413274 5:160956442-160956464 CTCAATGAAAATTTATAGACAGG - Intergenic
1000815866 5:165920952-165920974 TTCTCTGAGAATTAGGAGAATGG - Intergenic
1001593030 5:172879398-172879420 TTCCATGAGAATGTACAGGAAGG - Intronic
1003286704 6:4740597-4740619 TTGTCTGATAATTTATAAAAAGG - Intronic
1003681309 6:8260096-8260118 TTCTGTCAAAATTTATAGAGAGG - Intergenic
1004010365 6:11680364-11680386 TGCTATGAGAACATTTAGAAAGG + Intergenic
1004981024 6:21024209-21024231 TTCTAGGACAAAGTATAGAATGG + Intronic
1005370516 6:25127592-25127614 TTCCATCAGAATTAATTGAAAGG - Intergenic
1006015391 6:31076788-31076810 TTTTATGAGCATTAATAGCAGGG + Intergenic
1007886298 6:45233852-45233874 TTCTAAAAGAGTTAATAGAAAGG - Intronic
1007916740 6:45568390-45568412 TTCTATGAGACATTATACCAGGG + Intronic
1007932138 6:45701001-45701023 TGCTATCATAATTTATAAAAGGG + Intergenic
1007955351 6:45913145-45913167 ATCAATGAGTATTTATTGAATGG + Intronic
1008189276 6:48434421-48434443 GTCTTTGAGAAGTTAGAGAATGG + Intergenic
1009663786 6:66649832-66649854 TTCTATTAGAACTCTTAGAAAGG + Intergenic
1009694254 6:67079396-67079418 TGCTCTCAGAATTTATAGAAAGG - Intergenic
1010167092 6:72928501-72928523 TTCTTTAAAAATTTATAGAGAGG - Intronic
1010273718 6:73944703-73944725 TTTTAAGAGAATTTATAGTTTGG - Intergenic
1010689764 6:78895941-78895963 TTCTATCAGATTTTCTACAATGG - Intronic
1011547348 6:88495608-88495630 TACTATGCTATTTTATAGAAGGG - Intergenic
1011744228 6:90393871-90393893 TTCTAATAGAATTATTAGAAGGG + Intergenic
1011800163 6:91004174-91004196 TTTTATGAGGATTTGTAGAATGG + Intergenic
1012438439 6:99239312-99239334 ACCAATGAGAATTGATAGAATGG + Intergenic
1013172286 6:107647606-107647628 TTTTATGAGAATTTCTGGAATGG - Intronic
1013520303 6:110926596-110926618 TTCTATTAGAATTTGTCTAAAGG - Intergenic
1013646505 6:112146962-112146984 TTCTAAGAGAATTGATTGTAGGG - Intronic
1013961503 6:115906344-115906366 TTCTTTGAGAAATTATAACACGG - Intergenic
1014095693 6:117458159-117458181 TTATATGTAATTTTATAGAAGGG - Intronic
1014610282 6:123535131-123535153 TTCTATTTGAATTTTGAGAAGGG + Intronic
1014713205 6:124833581-124833603 TTCTATTTGTATTTAAAGAAAGG + Intergenic
1015738232 6:136424241-136424263 TTCCATGAGAACTTTTATAAGGG - Intronic
1015828826 6:137345479-137345501 TTTTATTCCAATTTATAGAAAGG + Intergenic
1018411824 6:163557028-163557050 TTATATGAGAATTTTCAGAGTGG + Intronic
1019194878 6:170275260-170275282 TTCTATGAGAATTTCTCTGAGGG - Intergenic
1020411582 7:7897582-7897604 TTCTTGGAGAATTTTAAGAAGGG + Intronic
1020641211 7:10756065-10756087 TTTGATGAGACTTTGTAGAATGG - Intergenic
1020643912 7:10790497-10790519 TTCTGTAAGAATTTAAATAAAGG - Intergenic
1021177757 7:17469636-17469658 TACTATGAGAATCCATAGATGGG - Intergenic
1022224929 7:28353370-28353392 TTCTAGGAGAATCTATGGGAGGG + Intronic
1022599065 7:31739317-31739339 TTCAAGGAAAATTTATAGAAAGG + Intergenic
1022707936 7:32823177-32823199 TGCCACAAGAATTTATAGAATGG + Intergenic
1023345101 7:39263893-39263915 TTCTATCAGCACTTATTGAAAGG - Intronic
1023420751 7:39977041-39977063 TGCTATGGGAGTTCATAGAATGG + Intronic
1023766657 7:43517807-43517829 TTCTTTGAGAATTGATAGGGAGG - Intronic
1026462920 7:70630645-70630667 TTCTATCAGAATATATCCAAGGG + Intronic
1026621570 7:71954155-71954177 CTCTATGAGAAATTTTAAAATGG + Intronic
1027635876 7:80673121-80673143 TTCCCCGAGAATTTATTGAAAGG + Intronic
1027841893 7:83323293-83323315 TTATATCAGAATTCATATAATGG - Intergenic
1028064361 7:86363560-86363582 TTATGTGAAAATTTATAGCAGGG + Intergenic
1028115156 7:86988515-86988537 TACTATGTCATTTTATAGAAGGG + Intronic
1028585087 7:92444828-92444850 TTCTATGCCATTTTATATAAGGG + Intergenic
1028732813 7:94171741-94171763 TTCTATGAAAATATATAATATGG - Intergenic
1029315980 7:99714248-99714270 TCCTTTGACAATTTATTGAAGGG + Intronic
1029321649 7:99766822-99766844 TCCTCTGACAATTTATTGAAGGG + Intronic
1029881870 7:103821894-103821916 CACTATTAGTATTTATAGAAGGG - Intronic
1030960582 7:115915894-115915916 TTGTATAAAAATTTTTAGAATGG - Intergenic
1031039102 7:116819875-116819897 TTCTCTGAGAATTATGAGAAGGG - Intronic
1031142113 7:117954289-117954311 TTCTAAGGGTATATATAGAAGGG - Intergenic
1031693725 7:124822161-124822183 TTCTATCAGTGTTTACAGAAAGG + Intergenic
1031829061 7:126603618-126603640 TTCTAACAGAATATAGAGAAAGG + Intronic
1032741579 7:134744872-134744894 TTCTATGAGAGTCCAGAGAAAGG - Intronic
1032878785 7:136066441-136066463 TTCAACAAGAATTTATTGAATGG + Intergenic
1032907887 7:136393155-136393177 TTCTAGCAGAATTTTCAGAAGGG + Intergenic
1033789078 7:144769401-144769423 CTTTATGAGAATTTATTAAAAGG + Intronic
1034716522 7:153247761-153247783 TACTATTTGAATTTATAGATGGG + Intergenic
1037042356 8:14251712-14251734 TTATATAAGAATTCATAAAAAGG + Intronic
1038317151 8:26495795-26495817 CTCTCTGAAAATTAATAGAAAGG + Intronic
1038732943 8:30143704-30143726 TTCTCTGAGAATTCATATAAAGG + Intronic
1038775270 8:30524574-30524596 TTTTTTGAAAAATTATAGAAAGG + Intronic
1039563714 8:38533875-38533897 TCCTAAGAGAAGTTTTAGAAGGG + Intergenic
1040747016 8:50656609-50656631 TTCTGTAAGAATTGATAGAGTGG + Intronic
1040866020 8:52049805-52049827 AGCTCTGAGAATTCATAGAAGGG + Intergenic
1041087021 8:54266272-54266294 TTCTATGAGAATAACTAAAAAGG + Intergenic
1041307735 8:56480192-56480214 TTCTATGAGAGTTTTAATAAGGG + Intergenic
1041453032 8:58027661-58027683 TTATATGAAATTTTAGAGAAAGG - Intronic
1041710633 8:60891126-60891148 ATCTCAGAGAATTTCTAGAAGGG + Intergenic
1043452606 8:80383048-80383070 ATCTATGAGTTTTTAAAGAAAGG - Intergenic
1044152112 8:88793859-88793881 TTCTAGGACAATTTGTAGAAAGG - Intergenic
1046084915 8:109421066-109421088 TTGTATGAAAATTTATACAAGGG + Intronic
1047986375 8:130238720-130238742 TTCAATAAATATTTATAGAAAGG + Intronic
1049962336 9:748742-748764 ATCTAGCAGAATTTAAAGAAAGG - Intergenic
1051560429 9:18435489-18435511 TACTATGAGAATATATAGGAGGG + Intergenic
1051941479 9:22510610-22510632 TTCTATTTTAATTTATACAAGGG + Intergenic
1051969328 9:22867824-22867846 TACTATGAGAATATAGACAATGG + Intergenic
1052570230 9:30211462-30211484 TTTTAAGAGAATAAATAGAATGG - Intergenic
1052983806 9:34469878-34469900 TTTTAAGAAAATTAATAGAAGGG - Intronic
1054356674 9:64069275-64069297 TTCTATTATTTTTTATAGAAGGG - Intergenic
1055366656 9:75551143-75551165 TGCTATGAAATTTTATAGCAGGG - Intergenic
1055443455 9:76359234-76359256 TTCTATGTGATTTTAAAAAAAGG + Exonic
1055768915 9:79695084-79695106 TTCTATTACAATTTTTAAAAAGG + Intronic
1056489910 9:87095707-87095729 TTCTCGGAGAATTTTTAGTACGG - Intergenic
1058591929 9:106574654-106574676 TTCTATGTGAATTTATTTGAAGG - Intergenic
1059040107 9:110804262-110804284 TTTTATGAAAATTCAGAGAAAGG + Intergenic
1059062880 9:111052069-111052091 TTCTAAGAAAATATCTAGAAAGG + Intergenic
1059126493 9:111691992-111692014 TTTTCTGAGAATTTATAAAACGG + Exonic
1059165997 9:112077021-112077043 TTCAAGGAGTTTTTATAGAAAGG + Intronic
1059910421 9:119037524-119037546 CTCTATGAGAATCTTTATAAGGG - Intergenic
1060070634 9:120543883-120543905 AGCTATGAGAATTTATAGGTAGG - Intronic
1060315849 9:122509782-122509804 TCCTTTGAGAATTTTTAGACAGG + Intergenic
1203427016 Un_GL000195v1:50595-50617 TTCTTTGAGAATGCAAAGAATGG + Intergenic
1203748213 Un_GL000218v1:56015-56037 TTCTATTATTTTTTATAGAAGGG - Intergenic
1203561513 Un_KI270744v1:61989-62011 TTCTATTATGTTTTATAGAAGGG + Intergenic
1203681041 Un_KI270756v1:64370-64392 TTTTATGGAAATATATAGAATGG - Intergenic
1185788735 X:2912286-2912308 TTATCTGAGAATCAATAGAAGGG - Intronic
1186526634 X:10255148-10255170 TTTTATGGGAATTTATACCAGGG + Intergenic
1186556932 X:10569736-10569758 TGTGATGAGAATTTCTAGAAAGG + Intronic
1186646755 X:11514955-11514977 GGCTATGAGAATTTACAGATAGG - Intronic
1186781603 X:12917466-12917488 TTTTAGGAGAATTTTTAAAAAGG + Intronic
1187321358 X:18240702-18240724 TTCTATCAGTATATCTAGAAAGG - Exonic
1188447557 X:30272003-30272025 TTTTTTGAGAACATATAGAAGGG - Intergenic
1188726158 X:33585125-33585147 TTTTATGGTAATTTATGGAAAGG - Intergenic
1188930955 X:36110344-36110366 TTCTGTCAGTATTTATTGAATGG + Intronic
1191166433 X:57397435-57397457 TTCTATGAGCATTTCTTGTAGGG + Intronic
1193938179 X:87648288-87648310 CTCAAGGAAAATTTATAGAATGG + Intronic
1194325837 X:92515310-92515332 TCTTATGTGAATTTAAAGAAAGG + Intronic
1194649176 X:96495411-96495433 TGCTATGAGAAGTCATAAAAGGG + Intergenic
1194691026 X:96984891-96984913 TTCCATGAGAATTAATTAAATGG - Intronic
1197080330 X:122405326-122405348 TATCATGAGAATGTATAGAATGG + Intergenic
1197689873 X:129487074-129487096 TTCTCTAAGAAATTTTAGAATGG - Exonic
1198070080 X:133139575-133139597 TTTTATGAGAATATTTATAAAGG + Intergenic
1199048431 X:143205904-143205926 TTCTTTGAGAGTTTCTTGAATGG + Intergenic
1199273553 X:145914613-145914635 ATCTATGAGAACCTATAGAACGG + Intergenic
1199904257 X:152208311-152208333 TTCAATGAGAGTTTATTGTATGG - Intronic
1199923383 X:152434706-152434728 TTCTATGGGAAATGGTAGAATGG + Intronic
1200634559 Y:5634468-5634490 TCTTATGTGAATTTAAAGAAAGG + Intronic
1201161561 Y:11170988-11171010 TTCTATTATTTTTTATAGAAGGG - Intergenic
1201286198 Y:12380835-12380857 TTATCTGAGAATCAATAGAAGGG + Intergenic
1201962636 Y:19699233-19699255 TTTGATGAAAATTTATGGAATGG - Intergenic
1202073223 Y:21014205-21014227 TAAAATGAGAATTTCTAGAATGG + Intergenic
1202077923 Y:21056059-21056081 TAAAATGAGAATTTCTAGAATGG + Intergenic
1202595410 Y:26534463-26534485 TTCTTCGAGTATTTGTAGAAGGG + Intergenic