ID: 1175572749

View in Genome Browser
Species Human (GRCh38)
Location 20:60036621-60036643
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175572749_1175572751 -9 Left 1175572749 20:60036621-60036643 CCTCCAGGCTTTTGCTTACTCTG No data
Right 1175572751 20:60036635-60036657 CTTACTCTGTGCCCTCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175572749 Original CRISPR CAGAGTAAGCAAAAGCCTGG AGG (reversed) Intergenic
No off target data available for this crispr