ID: 1175574832

View in Genome Browser
Species Human (GRCh38)
Location 20:60052963-60052985
Sequence AATTTAATGAAAGCTGTTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175574832_1175574841 27 Left 1175574832 20:60052963-60052985 CCAATAACAGCTTTCATTAAATT No data
Right 1175574841 20:60053013-60053035 AATAACAGGCTGCTTATATATGG No data
1175574832_1175574838 13 Left 1175574832 20:60052963-60052985 CCAATAACAGCTTTCATTAAATT No data
Right 1175574838 20:60052999-60053021 TTATATTCCCTGGGAATAACAGG No data
1175574832_1175574837 4 Left 1175574832 20:60052963-60052985 CCAATAACAGCTTTCATTAAATT No data
Right 1175574837 20:60052990-60053012 CCAAGGCATTTATATTCCCTGGG No data
1175574832_1175574842 30 Left 1175574832 20:60052963-60052985 CCAATAACAGCTTTCATTAAATT No data
Right 1175574842 20:60053016-60053038 AACAGGCTGCTTATATATGGCGG No data
1175574832_1175574835 3 Left 1175574832 20:60052963-60052985 CCAATAACAGCTTTCATTAAATT No data
Right 1175574835 20:60052989-60053011 CCCAAGGCATTTATATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175574832 Original CRISPR AATTTAATGAAAGCTGTTAT TGG (reversed) Intergenic
No off target data available for this crispr