ID: 1175574835

View in Genome Browser
Species Human (GRCh38)
Location 20:60052989-60053011
Sequence CCCAAGGCATTTATATTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175574832_1175574835 3 Left 1175574832 20:60052963-60052985 CCAATAACAGCTTTCATTAAATT No data
Right 1175574835 20:60052989-60053011 CCCAAGGCATTTATATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175574835 Original CRISPR CCCAAGGCATTTATATTCCC TGG Intergenic
No off target data available for this crispr