ID: 1175574838

View in Genome Browser
Species Human (GRCh38)
Location 20:60052999-60053021
Sequence TTATATTCCCTGGGAATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175574832_1175574838 13 Left 1175574832 20:60052963-60052985 CCAATAACAGCTTTCATTAAATT No data
Right 1175574838 20:60052999-60053021 TTATATTCCCTGGGAATAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175574838 Original CRISPR TTATATTCCCTGGGAATAAC AGG Intergenic
No off target data available for this crispr