ID: 1175574842

View in Genome Browser
Species Human (GRCh38)
Location 20:60053016-60053038
Sequence AACAGGCTGCTTATATATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175574832_1175574842 30 Left 1175574832 20:60052963-60052985 CCAATAACAGCTTTCATTAAATT No data
Right 1175574842 20:60053016-60053038 AACAGGCTGCTTATATATGGCGG No data
1175574834_1175574842 4 Left 1175574834 20:60052989-60053011 CCCAAGGCATTTATATTCCCTGG No data
Right 1175574842 20:60053016-60053038 AACAGGCTGCTTATATATGGCGG No data
1175574836_1175574842 3 Left 1175574836 20:60052990-60053012 CCAAGGCATTTATATTCCCTGGG No data
Right 1175574842 20:60053016-60053038 AACAGGCTGCTTATATATGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175574842 Original CRISPR AACAGGCTGCTTATATATGG CGG Intergenic
No off target data available for this crispr