ID: 1175575490

View in Genome Browser
Species Human (GRCh38)
Location 20:60057761-60057783
Sequence AAATGGGCATCAGCACCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175575490_1175575497 15 Left 1175575490 20:60057761-60057783 CCAGTGGGTGCTGATGCCCATTT 0: 1
1: 1
2: 1
3: 11
4: 154
Right 1175575497 20:60057799-60057821 TCCCCTGTAGGGAGGACAGATGG 0: 1
1: 0
2: 2
3: 25
4: 218
1175575490_1175575491 -8 Left 1175575490 20:60057761-60057783 CCAGTGGGTGCTGATGCCCATTT 0: 1
1: 1
2: 1
3: 11
4: 154
Right 1175575491 20:60057776-60057798 GCCCATTTGTTTGTGCAAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 115
1175575490_1175575496 7 Left 1175575490 20:60057761-60057783 CCAGTGGGTGCTGATGCCCATTT 0: 1
1: 1
2: 1
3: 11
4: 154
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1175575490_1175575495 4 Left 1175575490 20:60057761-60057783 CCAGTGGGTGCTGATGCCCATTT 0: 1
1: 1
2: 1
3: 11
4: 154
Right 1175575495 20:60057788-60057810 GTGCAAGTTGGTCCCCTGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 71
1175575490_1175575494 3 Left 1175575490 20:60057761-60057783 CCAGTGGGTGCTGATGCCCATTT 0: 1
1: 1
2: 1
3: 11
4: 154
Right 1175575494 20:60057787-60057809 TGTGCAAGTTGGTCCCCTGTAGG 0: 1
1: 0
2: 1
3: 8
4: 107
1175575490_1175575501 25 Left 1175575490 20:60057761-60057783 CCAGTGGGTGCTGATGCCCATTT 0: 1
1: 1
2: 1
3: 11
4: 154
Right 1175575501 20:60057809-60057831 GGAGGACAGATGGTCTGTCTCGG 0: 1
1: 0
2: 1
3: 5
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175575490 Original CRISPR AAATGGGCATCAGCACCCAC TGG (reversed) Intronic
901266704 1:7916044-7916066 AAGTGGGCATCTTCCCCCACAGG - Exonic
902984626 1:20148133-20148155 AAAGGGGCAGCAGCTCCCCCAGG - Intronic
905783010 1:40729152-40729174 AAATGAGCATCGGCTTCCACAGG + Intronic
906955276 1:50368938-50368960 GCATGGGCACCAGCACCTACTGG + Intergenic
910327830 1:86030293-86030315 AAAATGGCAGCAGCACCCCCAGG - Intronic
910413874 1:86976731-86976753 AAATGGGCAGCAGGAGACACTGG - Intronic
910417730 1:87018375-87018397 AAATGGTCATCTGCACTCAATGG + Intronic
913044180 1:115059443-115059465 AACTGGGCTTCAGCATCAACTGG + Intronic
914336983 1:146724491-146724513 ATATGGGCTTCAGCACCAGCTGG + Intergenic
914720767 1:150286919-150286941 AGATGAGCATCAGCAGCAACTGG - Exonic
915750553 1:158205862-158205884 AAGTGGGCATCAGAACCACCTGG + Intergenic
917009011 1:170449905-170449927 AAATGTTCATCAGCACAGACTGG - Intergenic
917902096 1:179552641-179552663 AGCTGGGCTTCAGCACTCACTGG - Exonic
918058836 1:181045267-181045289 ACATGGGCATCTGCAGACACCGG + Intronic
918466603 1:184827272-184827294 ACTTGAGCTTCAGCACCCACAGG - Intronic
919298598 1:195733344-195733366 AAATGGCCTTGAGCACACACTGG + Intergenic
921176867 1:212603011-212603033 AACTGGACATGAGCACACACAGG - Intronic
922082537 1:222311032-222311054 AAATGGGCATCAGCACTCACTGG - Intergenic
922541394 1:226422910-226422932 TAATGGGCACCAGCACCCACTGG - Intergenic
1062908350 10:1195101-1195123 AGAGGTGCTTCAGCACCCACGGG - Intronic
1069306280 10:66974397-66974419 AAATGTCCATCAACACCAACAGG - Intronic
1073450442 10:103606000-103606022 AAACGGCCATCCGCACCCCCTGG - Intronic
1075547306 10:123364672-123364694 AAATGGGCATGAGCACAGACTGG + Intergenic
1076261365 10:129069751-129069773 AAATGGGCTTCATTACCCAAAGG + Intergenic
1077035061 11:490495-490517 CAACGGGGACCAGCACCCACTGG + Exonic
1079824508 11:25174565-25174587 AGAAGGGCATGAGAACCCACTGG - Intergenic
1081553806 11:44139058-44139080 AAATGTACACCAGAACCCACAGG - Intronic
1081867614 11:46368113-46368135 GAAAGGGCCTCAGCACCCAAAGG - Intronic
1083783285 11:64929275-64929297 CACTGAGCACCAGCACCCACTGG + Intronic
1088878427 11:113954838-113954860 AAATGGGCAGCAGAACTCAAAGG + Intergenic
1095768592 12:45924918-45924940 AAAGGAGCATGAACACCCACTGG + Exonic
1096034460 12:48453305-48453327 CAGTGGGCAACAGCACACACTGG + Intergenic
1096479187 12:51926564-51926586 AAATGGGCAGCAGCACCTAGAGG + Intergenic
1097134068 12:56836807-56836829 AAATGGCCTTGTGCACCCACTGG - Intergenic
1097151586 12:56983349-56983371 ATAAGGGCAACAGCACACACAGG + Intergenic
1097460828 12:59859722-59859744 AAATATGAATCAGCCCCCACAGG + Intergenic
1100069714 12:90699030-90699052 AATTGGGCTTCAGGAGCCACTGG + Intergenic
1100370623 12:93965975-93965997 AAGTGAGCATTAGCTCCCACAGG - Intergenic
1102738319 12:115182847-115182869 AGCTGAGCATCAGCGCCCACAGG + Intergenic
1103272906 12:119688326-119688348 AAATGGGAATCTGCAGCCCCTGG + Intronic
1105422035 13:20261557-20261579 GACTGGCCATCAGCTCCCACTGG - Intergenic
1105465821 13:20639066-20639088 AAATGGGCATCATCACCCCTGGG + Intronic
1106437754 13:29738921-29738943 AAATGGGGATGAGGACACACAGG - Intergenic
1107370837 13:39745481-39745503 AAATGCTCATCATCACTCACTGG + Intronic
1107380212 13:39849020-39849042 AAATGCTCATCATCACTCACTGG - Intergenic
1111892911 13:94105847-94105869 CAGTGGGCATTAACACCCACTGG - Intronic
1113557267 13:111247940-111247962 ACATGGGCCTCAGAACGCACAGG - Intronic
1114978328 14:28129247-28129269 AACTGGTCATCTCCACCCACTGG - Intergenic
1114980542 14:28158295-28158317 CAAGGGGCATCCGCATCCACAGG + Intergenic
1115898719 14:38120243-38120265 AAATGTGAATCAGCATCTACAGG + Intergenic
1117459010 14:55926321-55926343 CACTGGTCAGCAGCACCCACCGG + Intergenic
1121535452 14:94687537-94687559 AGATGGGCATCACACCCCACTGG + Intergenic
1122086675 14:99312491-99312513 AAATGGGCTTCTGCCCCCCCAGG + Intergenic
1122694962 14:103548097-103548119 GCATGGGCAGCAGAACCCACTGG - Intergenic
1133284094 16:4682669-4682691 AGAAGGGCATCACCAGCCACCGG - Intronic
1134400185 16:13902662-13902684 ACATCAGCATCAGCACCCATAGG - Intergenic
1136188718 16:28602822-28602844 AAATGCGCATGTGCACCCAGAGG + Intergenic
1138267525 16:55670632-55670654 AGATGGCCATCAGCAACCCCGGG + Intronic
1139950516 16:70666122-70666144 TGATGCGCATCAGCAGCCACGGG - Intronic
1139997287 16:70992828-70992850 ATATGGGCTTCAGCACCAGCCGG - Intronic
1140252042 16:73302738-73302760 AGATGGTCATCGTCACCCACCGG - Intergenic
1141339855 16:83193082-83193104 ACAAGGGCATCTGCACCTACAGG + Intronic
1141768023 16:86071470-86071492 AAATGGGCAGCTGCTCCCAGCGG - Intergenic
1144219363 17:13086117-13086139 AAATGGGCACCAGCAGGCACGGG - Intergenic
1147183718 17:38702651-38702673 AATGGGGCATCAGTACCCCCGGG - Intergenic
1148049019 17:44760029-44760051 CAGTGGGCTCCAGCACCCACCGG - Intronic
1148621191 17:49035858-49035880 AAATGGGCAAAAGCCCCAACTGG + Intronic
1151104381 17:71595455-71595477 AAATGGGCATCCCCAGCCAGGGG + Intergenic
1151380074 17:73719724-73719746 AAAGAGGCAGCAGCATCCACAGG - Intergenic
1152992657 18:377324-377346 CAATGGGCATCAGACCCCTCGGG - Intronic
1153987901 18:10369109-10369131 CAATGGGCACCACCAGCCACTGG - Intergenic
1154371476 18:13766470-13766492 AAAGGAGCACCAGCACACACAGG + Intergenic
1160118959 18:76109799-76109821 AAATGGCCATCCGGACCCAGAGG - Intergenic
1162402094 19:10452839-10452861 AAAGGGGCATCAGAGCCCATGGG - Intronic
1164666893 19:30045591-30045613 AACTTGGCATCAGCACCCTTTGG + Intergenic
1168147684 19:54429125-54429147 AGCTGGACATCAGCAGCCACTGG + Intronic
927381848 2:22488426-22488448 ACATGGGCATCAGGAACTACAGG - Intergenic
927429250 2:23013024-23013046 AAAAGGATATCAGGACCCACAGG - Intergenic
927562447 2:24083624-24083646 AAATGTGCATCAGAATCCCCCGG - Intronic
929256486 2:39816664-39816686 AAATGGACATCAGCTCACACTGG - Intergenic
929438764 2:41949059-41949081 AAATGGGCATCAGCTTCCTGCGG - Intronic
930320339 2:49846160-49846182 AAATGGGCAACAACAACTACAGG + Intergenic
932230882 2:70083331-70083353 AAATGGGCATAAGACCCTACTGG + Intergenic
938117421 2:128611541-128611563 AAATAGCCAGCAGCACCTACAGG - Intergenic
946803756 2:223449393-223449415 AATTGTGCTTCAGCAGCCACTGG - Intergenic
946815674 2:223576031-223576053 AAATGGGCTTAAACACCCAGGGG + Intergenic
948467064 2:238157768-238157790 AAAGGGGCACCAGCAGCCGCAGG - Intergenic
1169805176 20:9551847-9551869 TACTGAGCATCAGAACCCACTGG - Intronic
1172119513 20:32589529-32589551 GAAGGGGCACCAGCACCCAGTGG - Intronic
1173149016 20:40550128-40550150 TCAGGGGCATCAGCATCCACTGG - Intergenic
1173221202 20:41134487-41134509 AAAAGTGCATCAGAGCCCACAGG + Intergenic
1175575490 20:60057761-60057783 AAATGGGCATCAGCACCCACTGG - Intronic
1180131882 21:45832072-45832094 AAATGGGCACCAGCAGCCCTCGG - Intronic
1180704852 22:17803023-17803045 TAGAGGGCATCAGAACCCACTGG + Intronic
1182111369 22:27726157-27726179 AAAGAGGTATCAGCACCAACAGG + Intergenic
1184664127 22:45978503-45978525 CATTGGGGATCAGCACACACAGG + Intergenic
1185203160 22:49520915-49520937 ACATGGGCATGAGCACCAAGAGG + Intronic
1185384131 22:50524027-50524049 CAAAGTACATCAGCACCCACTGG + Exonic
950895563 3:16447447-16447469 AAATCGACATCAGCACTCTCTGG + Intronic
950899961 3:16488629-16488651 AAATAGGCATTAACACCAACTGG - Intronic
951501836 3:23397034-23397056 AAATGGGCATAATCATACACTGG - Intronic
952108079 3:30092175-30092197 AAATCTGCATTGGCACCCACAGG - Intergenic
952491433 3:33877588-33877610 AAAGGGGCACCTGCACCCACAGG - Intergenic
953896660 3:46808446-46808468 AAACAGGCAGCAGGACCCACTGG + Intronic
954213098 3:49109199-49109221 AAACGGCCATCAGCACCCCGGGG + Intronic
955343307 3:58142393-58142415 AAATTCCCAGCAGCACCCACGGG - Intronic
955345239 3:58156156-58156178 AAAGGGGCCTCAGCACCTAAGGG - Intronic
955989732 3:64613470-64613492 AAAAGGGCATAAGCACCGCCAGG - Exonic
957040393 3:75331670-75331692 AAATGGGTGCCAGCACCCAATGG - Intergenic
958253917 3:91302553-91302575 ATATGGGCATCCGCAGCCACAGG + Intergenic
959181003 3:102980340-102980362 AAGTGCGCACCAGAACCCACTGG + Intergenic
961045183 3:123703249-123703271 AAATGGGTGCCAGCACCCAAGGG - Intronic
961722886 3:128907973-128907995 AGATGGCCATGAGCTCCCACTGG - Intronic
962609655 3:137063773-137063795 AAGTGGGAATCTGCACCCTCAGG - Intergenic
963993837 3:151684244-151684266 AAATGGGGAACAACACACACTGG + Intergenic
965536654 3:169830405-169830427 AAAAATGCATGAGCACCCACAGG + Intronic
967043689 3:185717220-185717242 GAGTGGGCATCAGGACCAACGGG + Exonic
967393061 3:188976080-188976102 AAATGGGCTTCACCAACAACAGG - Intronic
968215852 3:196889748-196889770 AACTGAGAATCAGCTCCCACTGG + Intronic
969053396 4:4387522-4387544 AAGTGGGCACCCACACCCACCGG - Intronic
970176096 4:13340900-13340922 AGATGGCCATCACCACTCACTGG - Intergenic
971006718 4:22382562-22382584 AAATGGGCACCAGCAGCCCTCGG + Intronic
971807234 4:31374689-31374711 AAATTGCCATCAGCAACTACTGG - Intergenic
975808324 4:78136973-78136995 GAGTGGGCACCAGCACACACAGG + Intronic
978333649 4:107643307-107643329 AAAGGAGCAGCAGCACCCAAAGG + Intronic
981933355 4:150213367-150213389 CAATCGGAATCAGCACCCAGAGG - Intronic
982067922 4:151671087-151671109 ACATGGGCATCAGCTTTCACAGG + Exonic
984706679 4:182852274-182852296 AAATGGGCACCAGCAGCCCTCGG + Intergenic
985109511 4:186534477-186534499 ATATCGACATCAGCACCAACGGG + Exonic
986442769 5:7796297-7796319 AAAAAGTCATCAGCAACCACAGG - Intronic
986494444 5:8328421-8328443 AATTGGGCATCAGCACTAAGGGG + Intergenic
988344287 5:30018025-30018047 AAAATGGCACCAGCAACCACTGG - Intergenic
993653727 5:90553078-90553100 TAATGAGCATCTGCACCCACTGG - Intronic
997851329 5:137335316-137335338 AAATATGCATCAGCACACATTGG + Intronic
1000024002 5:157343179-157343201 GAATGGCCATCAGCACCCAAAGG + Exonic
1000116415 5:158158082-158158104 AAATGGCCACCAGCACCTCCAGG - Intergenic
1002575603 5:180172196-180172218 CAGTGGGCAACAGCAGCCACTGG + Intronic
1007561067 6:42808815-42808837 AAATGGGAAACAGGACCCAGAGG + Intronic
1009190572 6:60624486-60624508 ATATGGGCATCCGCAGCCACAGG - Intergenic
1009330074 6:62408077-62408099 AAATAGGCATTTGCTCCCACTGG - Intergenic
1011217683 6:85022398-85022420 AAATAGGAATGAGCCCCCACTGG + Intergenic
1016786522 6:148016467-148016489 AAATAGGACTCAGCACCCAGTGG - Intergenic
1018204604 6:161425642-161425664 AAAGGTGCCTCATCACCCACTGG + Intronic
1018643071 6:165922742-165922764 AAATGGACAGCACTACCCACGGG - Intronic
1018936453 6:168276971-168276993 AAATGGCAACCAGCACACACTGG - Intergenic
1023159694 7:37285128-37285150 ACAGGGACATCACCACCCACGGG - Intronic
1030100432 7:105940800-105940822 AACTGGGGTTCAGCACCAACTGG - Intronic
1034383432 7:150718956-150718978 AAATAGGCATAACCACCTACAGG - Intronic
1037627432 8:20620300-20620322 TAATGGGCTGCAGCACCCAAGGG - Intergenic
1039433671 8:37545257-37545279 AAATGGCTATCAACTCCCACTGG + Intergenic
1042185743 8:66134947-66134969 AAATGTCCATCAGCTCTCACTGG - Intronic
1043506933 8:80911475-80911497 AAAATGGCATCAGCACCAAAAGG + Intergenic
1048873444 8:138817397-138817419 AAGCAGGCATCAACACCCACAGG - Intronic
1051467535 9:17397338-17397360 AAATGGGCAACCGCAGCCCCTGG - Intronic
1054772055 9:69092297-69092319 AAATGGGCAACAGCAGCCCTCGG - Intronic
1057143309 9:92740870-92740892 AGATGGGCATCGGCACCAGCAGG + Intronic
1057659284 9:96986190-96986212 AAATGGGCACCAGCAGCCCTCGG + Intronic
1060113793 9:120925723-120925745 AGAAAGGCATCAGCTCCCACAGG - Intronic
1061799371 9:133105644-133105666 AGATGGGCATCAGGACCAGCAGG - Intronic
1062132642 9:134908149-134908171 AAATGCAAATCAGCACCCAAAGG - Intronic
1062729181 9:138099430-138099452 ACATGGGCATATGCACACACAGG - Intronic
1188710092 X:33385758-33385780 AAATTGGCCTCAGCAATCACTGG + Intergenic
1189976520 X:46465756-46465778 AGATGGGCATCAGAACCCTCTGG - Intronic
1190901368 X:54677034-54677056 TAATGGGGAACAACACCCACTGG + Intergenic
1191607488 X:63078516-63078538 AAATGGCCATGAGCACCTGCTGG + Intergenic
1192202389 X:69074863-69074885 ACCTGGGCATCAGCACCTGCAGG - Intergenic
1194844250 X:98783794-98783816 AAATGGCCATTAGCACCATCGGG + Intergenic
1201985259 Y:19958399-19958421 AAGTGCCCATCAGAACCCACTGG + Intergenic