ID: 1175575492

View in Genome Browser
Species Human (GRCh38)
Location 20:60057777-60057799
Sequence ACCAACTTGCACAAACAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175575492_1175575496 -9 Left 1175575492 20:60057777-60057799 CCCATTTGTTTGTGCAAGTTGGT 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1175575492_1175575501 9 Left 1175575492 20:60057777-60057799 CCCATTTGTTTGTGCAAGTTGGT 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1175575501 20:60057809-60057831 GGAGGACAGATGGTCTGTCTCGG 0: 1
1: 0
2: 1
3: 5
4: 179
1175575492_1175575497 -1 Left 1175575492 20:60057777-60057799 CCCATTTGTTTGTGCAAGTTGGT 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1175575497 20:60057799-60057821 TCCCCTGTAGGGAGGACAGATGG 0: 1
1: 0
2: 2
3: 25
4: 218
1175575492_1175575502 18 Left 1175575492 20:60057777-60057799 CCCATTTGTTTGTGCAAGTTGGT 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1175575502 20:60057818-60057840 ATGGTCTGTCTCGGACTTTCTGG 0: 1
1: 0
2: 1
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175575492 Original CRISPR ACCAACTTGCACAAACAAAT GGG (reversed) Intronic
911116983 1:94256352-94256374 AACACTTTGCACATACAAATGGG + Intronic
911892152 1:103385103-103385125 ACCATCTTGGACATAGAAATGGG - Intergenic
912750091 1:112280290-112280312 ACCAACTTGGAAAATCAAGTTGG + Intergenic
916703039 1:167317853-167317875 ATCATCTTGCAAAAACAAAAAGG - Intronic
918172812 1:182013851-182013873 ACTAAGTTGCACAAACATGTAGG + Intergenic
919561231 1:199122341-199122363 GCCAACCTGCACCAACATATTGG - Intergenic
919620116 1:199855288-199855310 ACCAAAATACACAAACAAAGTGG - Intergenic
1064939270 10:20714478-20714500 GCCAACCTGCACAAATATATGGG + Intergenic
1071123028 10:82302067-82302089 ACCAAGTTGAAAAAAAAAATAGG - Intronic
1072027990 10:91483279-91483301 AACAGCTTGTGCAAACAAATTGG - Intronic
1072130853 10:92492533-92492555 ACCAAGTTGCCCAAGCTAATTGG - Intronic
1073601945 10:104854577-104854599 ACAAACTCACACAAAAAAATGGG - Intronic
1073924217 10:108496394-108496416 ACTGTCTTCCACAAACAAATTGG - Intergenic
1074620115 10:115109938-115109960 GCCAAATTGTATAAACAAATTGG + Intronic
1075891254 10:125953246-125953268 ACCAAACTGCACAAACAGAGGGG - Intronic
1076759740 10:132596728-132596750 ACAAACATGCACACACACATGGG - Intronic
1077378552 11:2217119-2217141 ACCATCATGCACAAACAACAGGG + Intergenic
1080460848 11:32453611-32453633 ACAAAATTGCTCAAACAAAATGG - Intergenic
1081676087 11:44970439-44970461 ACCAAATTGCCCAAGCAATTTGG - Intergenic
1085614127 11:77982012-77982034 AGCAACTTGCACCAACAACTGGG + Intronic
1085914987 11:80875735-80875757 GCCAGCTAGCATAAACAAATAGG - Intergenic
1086262154 11:84953144-84953166 ACCTCTTTGAACAAACAAATCGG + Intronic
1087412973 11:97815398-97815420 AGCAATATGCATAAACAAATTGG + Intergenic
1095332582 12:40986096-40986118 CACAACTTGTATAAACAAATAGG - Intronic
1103706517 12:122877189-122877211 GCAAACTTGAACAAACAAATGGG + Intronic
1107572386 13:41676584-41676606 ACCACCTTGCACAATAAAATAGG - Intronic
1108559172 13:51626410-51626432 ACCAACATACACAAAAATATAGG + Intronic
1109201599 13:59437418-59437440 AAAAACTTGCACTAAAAAATAGG - Intergenic
1111605718 13:90536352-90536374 AGGAACTTGCCCAAACTAATGGG + Intergenic
1113224515 13:108144660-108144682 TCCAAGTTGAAAAAACAAATGGG - Intergenic
1114574458 14:23699774-23699796 ATAAGGTTGCACAAACAAATTGG + Intergenic
1115024276 14:28722549-28722571 AACAACTTGAACAAAAAACTAGG - Intergenic
1115749705 14:36477149-36477171 ACACACGTGCACAAACATATTGG - Intronic
1115930610 14:38488124-38488146 ATCAACATGCAAAAAAAAATTGG - Intergenic
1116252878 14:42509077-42509099 ACCATCCTGGACAAACGAATAGG + Intergenic
1116654717 14:47637719-47637741 ACTAACTTGCACTTACAATTTGG - Intronic
1118929462 14:70227261-70227283 ACATACTTTCACACACAAATGGG - Intergenic
1118969872 14:70625919-70625941 AACAATTTTCACCAACAAATTGG + Intergenic
1119564439 14:75616643-75616665 CCCAATTTGCTCAAACCAATTGG - Intronic
1121950465 14:98167030-98167052 GCCAACGTTGACAAACAAATGGG + Intergenic
1123478581 15:20610982-20611004 ACCACTTTGGACAAAGAAATCGG - Intergenic
1123639432 15:22389403-22389425 ACCACTTTGGACAAAGAAATCGG + Intergenic
1123706988 15:22957805-22957827 AACAGCTTGCACAAAAATATTGG - Intronic
1125480875 15:40079377-40079399 ACCCATTTGCACAAACATTTTGG + Intergenic
1125827015 15:42685156-42685178 ACCTACTTGCTCAAACTCATAGG + Exonic
1125983679 15:44028219-44028241 ACCAACATGCCCATACAAAAGGG + Intronic
1129071491 15:72955053-72955075 ACCAACTTGTACTTACAGATGGG - Intergenic
1130161606 15:81407223-81407245 AGCAAATTGCACCAAGAAATTGG + Intergenic
1130613992 15:85386763-85386785 ATCAACTTGCAAAAAAAAAAAGG - Intronic
1130808105 15:87348282-87348304 ATAAACATACACAAACAAATGGG + Intergenic
1135786179 16:25351278-25351300 ACCAGATTGCACTAATAAATGGG - Intergenic
1139259766 16:65580194-65580216 ACAAATTTGCACAAGCACATGGG + Intergenic
1139800985 16:69522570-69522592 CCAAACTTGCTCAAATAAATTGG + Intergenic
1140250211 16:73288504-73288526 ACCAGCTTGGAAAAACAAAAAGG + Intergenic
1150592559 17:66576535-66576557 AGCACCTTGCAAAAACCAATAGG - Intronic
1151229734 17:72675686-72675708 ACCATCTTACACACACAATTGGG - Intronic
1168174761 19:54617476-54617498 ACCAGCTTGCAAAAAAAATTTGG - Intronic
927737964 2:25539308-25539330 ACCACTTTGTAAAAACAAATTGG - Intronic
928064356 2:28148374-28148396 ACCAACCTACACATACAATTTGG - Intronic
928660933 2:33500999-33501021 AACAACTAGCACTATCAAATTGG + Intronic
929626924 2:43418928-43418950 ACTAAACTGCACCAACAAATAGG - Intronic
930141537 2:47955627-47955649 ACCATCTTGGACAAAGGAATGGG + Intergenic
933165653 2:79071946-79071968 AACAAAATTCACAAACAAATGGG + Intergenic
937073916 2:119087280-119087302 ACCAACCTTCTGAAACAAATGGG - Intergenic
939683540 2:145169348-145169370 ACCAAAATGCACAAAGAACTGGG + Intergenic
940526855 2:154826797-154826819 ACACACGTGCACAAACAGATAGG - Intronic
940585440 2:155642940-155642962 ACCAACTTGTCCAAAGAAATTGG + Intergenic
944637830 2:201691880-201691902 TCTAACTTTAACAAACAAATAGG + Intronic
946523074 2:220487629-220487651 ATCAACTTCAACAAACAAATTGG - Intergenic
1169688754 20:8306728-8306750 ACAAAATTGAACAAAAAAATTGG - Intronic
1170379722 20:15743867-15743889 ATCAACTTATACAAAAAAATAGG + Intronic
1170930091 20:20761943-20761965 ATCAACTTGCATAAACCAAGTGG - Intergenic
1173404875 20:42755873-42755895 ACAAAGTTGCAGAAAGAAATGGG + Intronic
1174764280 20:53237433-53237455 ATCATCTTGCACAAATAAACTGG - Intronic
1175575492 20:60057777-60057799 ACCAACTTGCACAAACAAATGGG - Intronic
1177466673 21:21493018-21493040 GCCAACATGCACTAAGAAATAGG - Intronic
1179466196 21:41575302-41575324 ACCAATTTGGAAAAAAAAATTGG - Intergenic
1184199847 22:42960920-42960942 ACCAACCTGCAAAAACAGACAGG + Intronic
952211291 3:31231558-31231580 ACCAACATGCAAAAGGAAATTGG + Intergenic
952682398 3:36109562-36109584 ACCAAGTTTCATAAACAAAAAGG + Intergenic
953936365 3:47047031-47047053 ACCAACTTGTAATAACAAACAGG + Intronic
954890159 3:53920076-53920098 AAAAACTTGCAAAAAAAAATTGG - Intergenic
956783286 3:72621704-72621726 ATCAACTTTTACAAACATATGGG + Intergenic
957600266 3:82324925-82324947 AACAGATGGCACAAACAAATGGG + Intergenic
961859793 3:129906773-129906795 ATCATCTTGCAAAAACAAAAAGG + Intergenic
963151949 3:142054048-142054070 GCCAACTTGTACAAACACTTTGG + Intronic
963791373 3:149586428-149586450 ACCAATTTGAATAACCAAATCGG + Intronic
965960599 3:174424303-174424325 ACCAATGTGCACAAACAAATGGG + Intergenic
967485628 3:190027128-190027150 ACTAACTTCACCAAACAAATGGG + Intronic
969157841 4:5228136-5228158 AATATCTTGCACAAACACATTGG - Intronic
970495402 4:16619760-16619782 AGCAACTTGCAAAGACAAAAGGG - Intronic
970535806 4:17028700-17028722 AACAACTTGACCAAACAAAGAGG + Intergenic
974210418 4:58766475-58766497 AACAACGTGCAAGAACAAATAGG - Intergenic
974462564 4:62206622-62206644 ACCAACTTGTGCAAAGGAATGGG + Intergenic
974655560 4:64815476-64815498 ACCAACTTGTTCACACACATAGG + Intergenic
974784743 4:66604381-66604403 ACCAACTAGCTGAAACAACTTGG + Intergenic
979214144 4:118142273-118142295 ACCAACTTACCAAAATAAATAGG + Intronic
979842862 4:125467543-125467565 AAGAACCAGCACAAACAAATGGG + Intronic
979934861 4:126679284-126679306 AGCTACTTGCAAAAATAAATTGG + Intergenic
979982292 4:127271941-127271963 ATCATCTTGCAAAAACAAAAAGG - Intergenic
980334279 4:131450181-131450203 TCCAACTGGTAAAAACAAATTGG + Intergenic
980659815 4:135842518-135842540 ACCAAATAGAACAAAAAAATAGG - Intergenic
981137674 4:141230640-141230662 ACCAACTAGCAGAAACAAACAGG - Intronic
981197467 4:141938361-141938383 ATCATCTTGCAAAAACAAAAAGG - Intergenic
982064075 4:151636872-151636894 ACAAACTTGAAGAAACAAGTTGG + Intronic
982643100 4:157987134-157987156 AACATCTTGCATTAACAAATGGG + Intergenic
983518561 4:168682031-168682053 TCCAACTTGCATAAATAAATTGG - Intronic
984708694 4:182866752-182866774 CTCAACTTGCACCAGCAAATGGG + Intergenic
984775561 4:183478693-183478715 AATAACTTGCACTAACTAATAGG - Intergenic
986387373 5:7247858-7247880 ACCAACTTCCATAAAAAAAAAGG + Intergenic
987161646 5:15150826-15150848 ACCAACTAGTAAAAATAAATTGG - Intergenic
987326323 5:16814446-16814468 ACCAACTTAAAAAAACAAAACGG - Intronic
989703594 5:44300578-44300600 TCTAACTTGGACAAACAAACAGG + Intergenic
989726561 5:44594298-44594320 AACAAGTTGCACAGACAGATAGG - Intergenic
990912489 5:60866533-60866555 ATAAACTTGCAAAATCAAATAGG + Intergenic
995711105 5:115036583-115036605 ATCATCTTGCAAAAACAAAAAGG - Intergenic
997334325 5:133094586-133094608 CCCACCTTCCACAAACATATAGG - Intronic
1000188729 5:158887107-158887129 ACCAATTGGCAAAAACAAATTGG + Intronic
1000930107 5:167241319-167241341 ACAAACTTGCACATACTTATAGG + Intergenic
1000930952 5:167250662-167250684 GCCACATTGCAGAAACAAATGGG - Intergenic
1005128945 6:22480682-22480704 AACAGCATGCAAAAACAAATGGG + Intergenic
1007040473 6:38716655-38716677 AGCAAAATGCACAATCAAATTGG - Intronic
1009029199 6:58036257-58036279 ACCAACTTGAACAAACATGAAGG - Intergenic
1009204740 6:60787655-60787677 ACCAACTTGAACAAACATGAAGG - Intergenic
1010961239 6:82148373-82148395 ACCAAATTGCAGAAAGGAATGGG - Intergenic
1011899518 6:92275022-92275044 ATGAGGTTGCACAAACAAATTGG + Intergenic
1011995440 6:93581287-93581309 ACAAACTTGTATCAACAAATTGG - Intergenic
1012849088 6:104425393-104425415 ACCAACTGGCACATATAGATTGG + Intergenic
1013881552 6:114908424-114908446 ACCAAGTTGCAGCAACAAGTTGG + Intergenic
1014264556 6:119261439-119261461 ACCAAGTTGCACAAACACTTGGG + Intronic
1014481293 6:121940577-121940599 ACATACTTACAAAAACAAATGGG - Intergenic
1014671379 6:124308694-124308716 ACCAACTAGCACCATAAAATGGG - Intronic
1016277101 6:142366912-142366934 ACCAACTGTGACAAACAAATGGG + Intronic
1018592573 6:165443262-165443284 AGAAACTGGCCCAAACAAATGGG + Intronic
1021826642 7:24559871-24559893 ACCAATTTTCACCTACAAATTGG - Intergenic
1022909435 7:34885947-34885969 ACAAATTTTCACAAACTAATTGG - Intergenic
1024060175 7:45691522-45691544 CCAAACCTGCACAAACAGATAGG + Intronic
1026457133 7:70582488-70582510 ACCACGTTGCCCAAAGAAATAGG + Intronic
1028028171 7:85873171-85873193 AACAATTTGCAAAAACATATAGG + Intergenic
1031714594 7:125092486-125092508 ACAAAATTACACAAATAAATGGG + Intergenic
1031824903 7:126551797-126551819 TCCATCTTGCACATAGAAATCGG + Intronic
1032941893 7:136803410-136803432 ACCCACTTAAACAAACCAATGGG + Intergenic
1035103322 7:156419393-156419415 AGCAATCTGCACAAACAACTGGG + Intergenic
1036815153 8:11896828-11896850 ACCAACTTCCACAAGCAGAAAGG - Intergenic
1037427384 8:18770882-18770904 AAGAGGTTGCACAAACAAATTGG + Intronic
1040319326 8:46284525-46284547 ATCATCTTGCAAAAACAAAAGGG + Intergenic
1040611780 8:48991906-48991928 ACAAACTTTAAGAAACAAATTGG + Intergenic
1041077202 8:54179587-54179609 ACCAACTCACACAAGCAACTTGG - Intergenic
1041531067 8:58867749-58867771 ACGAATTTGCACAAACTAATTGG + Intronic
1045581982 8:103491800-103491822 ACCATCTTGCACATAGGAATGGG + Intergenic
1045628425 8:104085575-104085597 AGCAACTGCCACAAATAAATAGG + Intronic
1046131229 8:109971143-109971165 ACATATTAGCACAAACAAATTGG - Intronic
1046142066 8:110106791-110106813 ACCATCTTGCACATAGGAATGGG + Intergenic
1046679605 8:117154013-117154035 ACCAAGTAGCATAAACAACTTGG + Intronic
1050281193 9:4051779-4051801 ACCAAACTCCACTAACAAATAGG + Intronic
1050716841 9:8538421-8538443 ACCAACAAGCTCAATCAAATGGG + Intronic
1052155312 9:25180556-25180578 ACCCACTTTCAACAACAAATAGG + Intergenic
1052671828 9:31567707-31567729 GACAACTTGCAAAAAAAAATAGG - Intergenic
1054998731 9:71424309-71424331 ACCAACTTTTAAAAACAGATTGG + Intronic
1055849356 9:80607322-80607344 ACCAACTTGCCCTCCCAAATGGG - Intergenic
1057555587 9:96085140-96085162 TCAAACTTGAACAAATAAATAGG + Intergenic
1057886551 9:98834122-98834144 CCCAACTTGAAAAAAAAAATAGG - Intronic
1187643913 X:21325870-21325892 AACAACGCGCAAAAACAAATGGG - Intergenic
1189202597 X:39210348-39210370 ACCACCTTCCACAAACACACTGG - Intergenic
1192831253 X:74752974-74752996 GCCATCTTCCACACACAAATGGG - Intronic
1195957923 X:110353088-110353110 ACAACCATACACAAACAAATTGG - Intronic
1197532576 X:127647863-127647885 ATCAAATTGTACAAACAAAAAGG + Intergenic
1197713898 X:129692194-129692216 ACAAACATGCACACACAAATGGG + Intergenic
1197842881 X:130768722-130768744 ACTAACTTGCAAAAATAACTCGG + Intronic