ID: 1175575496

View in Genome Browser
Species Human (GRCh38)
Location 20:60057791-60057813
Sequence CAAGTTGGTCCCCTGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175575493_1175575496 -10 Left 1175575493 20:60057778-60057800 CCATTTGTTTGTGCAAGTTGGTC No data
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG No data
1175575486_1175575496 26 Left 1175575486 20:60057742-60057764 CCAGGGGTCACGGCTGCTCCCAG No data
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG No data
1175575490_1175575496 7 Left 1175575490 20:60057761-60057783 CCAGTGGGTGCTGATGCCCATTT No data
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG No data
1175575489_1175575496 8 Left 1175575489 20:60057760-60057782 CCCAGTGGGTGCTGATGCCCATT No data
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG No data
1175575485_1175575496 27 Left 1175575485 20:60057741-60057763 CCCAGGGGTCACGGCTGCTCCCA No data
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG No data
1175575492_1175575496 -9 Left 1175575492 20:60057777-60057799 CCCATTTGTTTGTGCAAGTTGGT No data
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175575496 Original CRISPR CAAGTTGGTCCCCTGTAGGG AGG Intronic