ID: 1175575496

View in Genome Browser
Species Human (GRCh38)
Location 20:60057791-60057813
Sequence CAAGTTGGTCCCCTGTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175575490_1175575496 7 Left 1175575490 20:60057761-60057783 CCAGTGGGTGCTGATGCCCATTT 0: 1
1: 1
2: 1
3: 11
4: 154
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1175575492_1175575496 -9 Left 1175575492 20:60057777-60057799 CCCATTTGTTTGTGCAAGTTGGT 0: 1
1: 0
2: 1
3: 12
4: 155
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1175575493_1175575496 -10 Left 1175575493 20:60057778-60057800 CCATTTGTTTGTGCAAGTTGGTC 0: 1
1: 0
2: 1
3: 15
4: 179
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1175575486_1175575496 26 Left 1175575486 20:60057742-60057764 CCAGGGGTCACGGCTGCTCCCAG 0: 1
1: 0
2: 4
3: 28
4: 320
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1175575485_1175575496 27 Left 1175575485 20:60057741-60057763 CCCAGGGGTCACGGCTGCTCCCA 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1175575489_1175575496 8 Left 1175575489 20:60057760-60057782 CCCAGTGGGTGCTGATGCCCATT No data
Right 1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175575496 Original CRISPR CAAGTTGGTCCCCTGTAGGG AGG Intronic
900593473 1:3469937-3469959 CAAGCTGCTCACCTGTAGGCAGG + Intronic
901808105 1:11750394-11750416 CCAGTGGGTGCCCTGAAGGGAGG - Exonic
906829291 1:49014713-49014735 GAAGGAGGTTCCCTGTAGGGTGG - Intronic
910843681 1:91585578-91585600 CCAGTCGGTCCCCTGAAGGCAGG + Intergenic
913672350 1:121109337-121109359 CAAGTTATTCCCCTGTAAAGTGG - Intergenic
914024116 1:143896701-143896723 CAAGTTATTCCCCTGTAAGGTGG - Intergenic
914662604 1:149804730-149804752 CAAGTTATTCCCCTGTAAAGTGG - Intronic
917019226 1:170568408-170568430 CAAGGAGGCCCCCTGGAGGGAGG - Intergenic
917690363 1:177462266-177462288 CAAAATGGTCTCCTGTTGGGTGG + Intergenic
918406659 1:184218048-184218070 CATGATGGTTACCTGTAGGGTGG + Intergenic
1063666322 10:8062756-8062778 CAAGTTGGTCCCCCAGAGAGGGG - Intronic
1071998813 10:91174136-91174158 CAACTTGGGCCACTGTAGGTTGG + Intronic
1075584687 10:123649003-123649025 CCAGTTGCTCCTCTGTAAGGTGG + Intergenic
1075668559 10:124247739-124247761 CAAGATGGTGGCCTGTAGGGTGG - Intergenic
1076982649 11:213044-213066 CCATGTGGACCCCTGTAGGGTGG + Intronic
1076983186 11:216202-216224 CATGTTGGTCTCCTTTAGTGGGG - Exonic
1083868423 11:65471518-65471540 CAAGCTGGGGCCCTGTGGGGAGG - Intergenic
1084391150 11:68877967-68877989 CAAGGTGGTCCACAGCAGGGAGG - Intergenic
1090998815 11:131891141-131891163 CAAGCTAATCCCTTGTAGGGAGG + Intronic
1091786196 12:3244669-3244691 CCACATGGTCCCCTTTAGGGGGG - Intronic
1092287101 12:7134934-7134956 CAGCTTGGTGCCCTGTGGGGTGG + Intronic
1104467108 12:128999557-128999579 CCAGTGGGGCCCCTGCAGGGAGG + Intergenic
1110627597 13:77668736-77668758 CTGGTTGGTCTCCTGTGGGGAGG - Intergenic
1113459364 13:110471228-110471250 CACGGGGCTCCCCTGTAGGGGGG + Intronic
1117424320 14:55579892-55579914 CCAGGTGGTGCCCTGGAGGGAGG + Intronic
1121892514 14:97608114-97608136 CTAGTTGGCCCTTTGTAGGGTGG - Intergenic
1122127458 14:99586958-99586980 CAAGCAGGTCCCCGGTAGGAGGG - Intronic
1122534384 14:102451981-102452003 CAACTCGGTGCCCTGGAGGGAGG - Intronic
1124962396 15:34408770-34408792 CAAGCTGGTCTCCTCTAGGAAGG - Intronic
1124979020 15:34554992-34555014 CAAGCTGGTCTCCTCTAGGAAGG - Intronic
1125934308 15:43621612-43621634 CCATTTGGTCACCTGTAGGTTGG - Intergenic
1141961502 16:87412214-87412236 CCAGTGGGCCCCCTGCAGGGTGG - Exonic
1153691748 18:7601116-7601138 ACATTTGTTCCCCTGTAGGGTGG - Intronic
1162793655 19:13075757-13075779 CCAGTTGTCCCCCTGTCGGGGGG + Intronic
1165177678 19:33941975-33941997 CCAGTTGGTCCCCAGTCTGGTGG + Intergenic
935884595 2:107603178-107603200 CTAGATGGTCCCATCTAGGGGGG - Intergenic
937652499 2:124336252-124336274 AAAATTGGACCCCTTTAGGGAGG - Intronic
944702721 2:202260209-202260231 AAAGTTGATCCCCTGTTGGCTGG + Intergenic
944890441 2:204111619-204111641 GAAGTGGGCCCCCAGTAGGGAGG + Intergenic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1180166118 21:46030622-46030644 CAAATTGGTCCCCAGTGCGGTGG + Intergenic
1181002157 22:19992884-19992906 CCAGTGGGCCCCCTTTAGGGTGG - Intronic
1183211748 22:36455424-36455446 CAAGTTGAGCCCCTGCAGGGTGG - Intergenic
1183619573 22:38964714-38964736 CACCCTGGTCCCCTGTAAGGGGG - Intronic
1183640373 22:39089005-39089027 CACCCTGGTCCCCTGTAAGGGGG - Intergenic
1183898697 22:40989435-40989457 CAAGTTCTTACCCTGAAGGGCGG - Intergenic
961059502 3:123816527-123816549 CAGGTTGGTTCCCTGGAGTGTGG - Intronic
966800526 3:183759660-183759682 TAAGTTGGACCACTGTAAGGTGG - Intronic
971911784 4:32803805-32803827 CATTTTCGTCCCCTGTAGGGTGG - Intergenic
972148905 4:36064639-36064661 CAACCTGGTTCCCTGTGGGGAGG + Intronic
973162955 4:47041306-47041328 CAAGTTGGTCTCCTGGAAAGAGG + Intronic
974014489 4:56636177-56636199 CAAGTTTGCATCCTGTAGGGTGG - Intergenic
986996343 5:13611622-13611644 CAAGTTCATCACATGTAGGGAGG - Intergenic
997612085 5:135222401-135222423 CAAGCTCCTCCCATGTAGGGTGG - Intronic
1000952321 5:167499462-167499484 GAAGTTGCTCCATTGTAGGGTGG + Intronic
1013040838 6:106431798-106431820 CCAGCTGGCCCTCTGTAGGGTGG - Intergenic
1014505688 6:122251995-122252017 CAAGTTGAACCCCTGTAAGTTGG - Intergenic
1018055653 6:160050049-160050071 GCATTTGGTTCCCTGTAGGGAGG + Intronic
1024004084 7:45212560-45212582 CCAGCAGGTCTCCTGTAGGGTGG - Intergenic
1027507850 7:79040422-79040444 AAAGTTGGTCTCATGGAGGGTGG + Intronic
1030440658 7:109584336-109584358 CAATCTGGTTCCCTGAAGGGAGG - Intergenic
1031181031 7:118415483-118415505 CAATTTGATCCCCTAAAGGGAGG + Intergenic
1035205587 7:157292040-157292062 TGAGTTGGTCCCCTGTAGCTGGG - Intergenic
1036126537 8:6068267-6068289 CAAGATGATGCCATGTAGGGTGG - Intergenic
1043266755 8:78276170-78276192 CAAGTTGGTGTCCTATAGGTGGG - Intergenic
1045559309 8:103245606-103245628 CAAGTGAGTCCCCAGAAGGGAGG - Intergenic
1047426567 8:124751982-124752004 AAAGAAAGTCCCCTGTAGGGAGG + Intergenic
1051544029 9:18254140-18254162 CAATTTCCTCCCCTGTAGGATGG + Intergenic
1057880644 9:98790425-98790447 CCAGTTGCTCGCCTGAAGGGTGG + Exonic
1203455409 Un_GL000219v1:162704-162726 AAAGTTTGTCCCCCTTAGGGAGG + Intergenic
1185565194 X:1089691-1089713 CTCGTTGGTGCCCTGTTGGGTGG + Intergenic
1186211593 X:7255945-7255967 CAAGATGGCTGCCTGTAGGGTGG - Intronic
1196422344 X:115536110-115536132 AAAGTTGGTCTCTGGTAGGGTGG - Intergenic
1201584730 Y:15548247-15548269 CAAGATGGCCACCTGTGGGGTGG - Intergenic