ID: 1175576614

View in Genome Browser
Species Human (GRCh38)
Location 20:60065295-60065317
Sequence TGGTCCCGGTCTAAAGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175576610_1175576614 -3 Left 1175576610 20:60065275-60065297 CCTGCATCTATATTTCCATTTGG 0: 1
1: 0
2: 0
3: 14
4: 215
Right 1175576614 20:60065295-60065317 TGGTCCCGGTCTAAAGCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 38
1175576609_1175576614 -2 Left 1175576609 20:60065274-60065296 CCCTGCATCTATATTTCCATTTG 0: 1
1: 0
2: 1
3: 48
4: 513
Right 1175576614 20:60065295-60065317 TGGTCCCGGTCTAAAGCAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175576614 Original CRISPR TGGTCCCGGTCTAAAGCAGC TGG Intronic
904574842 1:31498661-31498683 TGGTCCCTGTTTTAAGCAGAGGG + Intergenic
909339569 1:74516586-74516608 CGGTCCAGGTCTCAAGCAGCAGG - Intronic
1067039371 10:42940845-42940867 TGGTCCCAGACTAGAGCTGCAGG + Intergenic
1074891036 10:117736833-117736855 AGGAGCCAGTCTAAAGCAGCTGG - Intergenic
1075086149 10:119415688-119415710 TGGCCCCAGTCAAAACCAGCTGG - Intronic
1087112144 11:94482338-94482360 GGGTTCCGGTATAAAACAGCTGG - Intronic
1094027465 12:25974090-25974112 TGGTCCAGGGAGAAAGCAGCGGG + Intronic
1096994592 12:55830718-55830740 TGGTCCTGGACTAGAGCAGTAGG + Exonic
1101330224 12:103751480-103751502 TGGTGCTGGGTTAAAGCAGCTGG + Intronic
1105606145 13:21927904-21927926 TTGTCCCCATCTAAATCAGCCGG + Intergenic
1105913387 13:24891680-24891702 TGTTCCCGGTCTACAGCAGTCGG + Intronic
1106274117 13:28187411-28187433 TGGTTCCAGTCTAAAGCACAAGG + Intronic
1112941225 13:104864377-104864399 TGGTCACTGTCTAAACCAGGTGG + Intergenic
1119292231 14:73504587-73504609 TGGTCCAGGACTTTAGCAGCAGG + Intronic
1123126046 14:105946953-105946975 TGGTCCCTGTATGAAGCAGTGGG - Intergenic
1127329823 15:57927780-57927802 TGGCCCCTGTCCAAGGCAGCAGG + Intergenic
1146465949 17:33086844-33086866 TGGTCCCTGTGAAAAGCATCTGG - Intronic
1155438151 18:25834197-25834219 TGGTGCCTGGCTAAAGCAGGCGG + Intergenic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1157483409 18:48070432-48070454 TGGTCCAGGTCAAGAGGAGCAGG + Intronic
1166252241 19:41579132-41579154 TGGTCCTGGTCTGAGGCAGCTGG + Intronic
1167320617 19:48795417-48795439 TGTTCCCGGTGTGAAGCTGCAGG - Exonic
946745951 2:222846125-222846147 TGGTGCAGGTCTACAGCAGTTGG + Intergenic
947768072 2:232650036-232650058 TGGCCCGGGTCAGAAGCAGCAGG + Intronic
1175485806 20:59345264-59345286 AGGTCCCGGGCTAAAGCACTAGG - Intergenic
1175576614 20:60065295-60065317 TGGTCCCGGTCTAAAGCAGCTGG + Intronic
953931116 3:47006161-47006183 TGGTCCAGGTCTACAGCCCCTGG - Exonic
961486935 3:127223190-127223212 TGGTCCTGGTCAGAAGCCGCAGG + Intergenic
962426010 3:135270106-135270128 TGTTCCTGGACTAAAGCACCAGG + Intergenic
977368874 4:96108775-96108797 TTGTTACGGGCTAAAGCAGCTGG + Intergenic
978950447 4:114552493-114552515 TGGTCCAGGACTCATGCAGCTGG + Intergenic
985996409 5:3599720-3599742 TGGTCCCGGGCAAGAGCAGAAGG - Exonic
989068978 5:37490613-37490635 TGGTCCCTGGCTGCAGCAGCAGG + Intronic
1000469816 5:161627476-161627498 TGGTCTGGGTCTAAGGCAGTGGG - Intronic
1004040859 6:11973624-11973646 TTGTCACAGTCTTAAGCAGCTGG + Intergenic
1011634654 6:89359933-89359955 TGGTCAAGGTCTCAGGCAGCTGG + Intergenic
1036623807 8:10447591-10447613 TGGTGCCTGTCTTGAGCAGCAGG - Intergenic
1044927390 8:97221211-97221233 TGGTCCCTGTCCAATCCAGCTGG - Intergenic
1051352531 9:16212074-16212096 AGGTCCCAGTCAAAAGCTGCAGG + Intronic
1059465875 9:114468614-114468636 TGGTCCTGGACTAAGGCAGCTGG - Intronic
1198312756 X:135437132-135437154 GGGTCCAGGTCTAGAGGAGCCGG - Intergenic
1199170138 X:144726003-144726025 TGGTGCAGCTCTAAAGCAGTTGG - Intergenic
1201401807 Y:13611598-13611620 TGGGCCCGGTAGAGAGCAGCAGG - Intergenic