ID: 1175578593

View in Genome Browser
Species Human (GRCh38)
Location 20:60081065-60081087
Sequence CTCCAAAGTAGGAATGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175578586_1175578593 8 Left 1175578586 20:60081034-60081056 CCCTTCACTGAGAGGATCCAGGT No data
Right 1175578593 20:60081065-60081087 CTCCAAAGTAGGAATGGGCAAGG No data
1175578588_1175578593 -9 Left 1175578588 20:60081051-60081073 CCAGGTGATGCAGCCTCCAAAGT No data
Right 1175578593 20:60081065-60081087 CTCCAAAGTAGGAATGGGCAAGG No data
1175578583_1175578593 30 Left 1175578583 20:60081012-60081034 CCTGACAGCTTGCTGCAGAGAGC No data
Right 1175578593 20:60081065-60081087 CTCCAAAGTAGGAATGGGCAAGG No data
1175578587_1175578593 7 Left 1175578587 20:60081035-60081057 CCTTCACTGAGAGGATCCAGGTG No data
Right 1175578593 20:60081065-60081087 CTCCAAAGTAGGAATGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175578593 Original CRISPR CTCCAAAGTAGGAATGGGCA AGG Intergenic
No off target data available for this crispr