ID: 1175579450

View in Genome Browser
Species Human (GRCh38)
Location 20:60087618-60087640
Sequence TCGCGGGTAAAACGGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175579450_1175579463 24 Left 1175579450 20:60087618-60087640 CCTGCCGCCCGTTTTACCCGCGA No data
Right 1175579463 20:60087665-60087687 CGTGCCGCCCGTTTTGCCCGCGG No data
1175579450_1175579465 26 Left 1175579450 20:60087618-60087640 CCTGCCGCCCGTTTTACCCGCGA No data
Right 1175579465 20:60087667-60087689 TGCCGCCCGTTTTGCCCGCGGGG No data
1175579450_1175579464 25 Left 1175579450 20:60087618-60087640 CCTGCCGCCCGTTTTACCCGCGA No data
Right 1175579464 20:60087666-60087688 GTGCCGCCCGTTTTGCCCGCGGG No data
1175579450_1175579457 -7 Left 1175579450 20:60087618-60087640 CCTGCCGCCCGTTTTACCCGCGA No data
Right 1175579457 20:60087634-60087656 CCCGCGAGGAAGCCGAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175579450 Original CRISPR TCGCGGGTAAAACGGGCGGC AGG (reversed) Intergenic