ID: 1175579489

View in Genome Browser
Species Human (GRCh38)
Location 20:60087758-60087780
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175579489_1175579496 -7 Left 1175579489 20:60087758-60087780 CCTGCCGCCCGTTTTACCCGCGA No data
Right 1175579496 20:60087774-60087796 CCCGCGAGGAAGCCGAGGCCCGG No data
1175579489_1175579503 24 Left 1175579489 20:60087758-60087780 CCTGCCGCCCGTTTTACCCGCGA No data
Right 1175579503 20:60087805-60087827 CCTGCCGCCCGTTTTACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175579489 Original CRISPR TCGCGGGTAAAACGGGCGGC AGG (reversed) Intergenic