ID: 1175579968

View in Genome Browser
Species Human (GRCh38)
Location 20:60090784-60090806
Sequence CTGCTTCAGCAGAATCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175579959_1175579968 21 Left 1175579959 20:60090740-60090762 CCCATCCCCTGGTGGGTCATTTT No data
Right 1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG No data
1175579958_1175579968 24 Left 1175579958 20:60090737-60090759 CCACCCATCCCCTGGTGGGTCAT No data
Right 1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG No data
1175579960_1175579968 20 Left 1175579960 20:60090741-60090763 CCATCCCCTGGTGGGTCATTTTA No data
Right 1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG No data
1175579964_1175579968 14 Left 1175579964 20:60090747-60090769 CCTGGTGGGTCATTTTAAGTGGT No data
Right 1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG No data
1175579962_1175579968 15 Left 1175579962 20:60090746-60090768 CCCTGGTGGGTCATTTTAAGTGG No data
Right 1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG No data
1175579961_1175579968 16 Left 1175579961 20:60090745-60090767 CCCCTGGTGGGTCATTTTAAGTG No data
Right 1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG No data
1175579957_1175579968 25 Left 1175579957 20:60090736-60090758 CCCACCCATCCCCTGGTGGGTCA No data
Right 1175579968 20:60090784-60090806 CTGCTTCAGCAGAATCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175579968 Original CRISPR CTGCTTCAGCAGAATCTGAG CGG Intergenic
No off target data available for this crispr