ID: 1175582665

View in Genome Browser
Species Human (GRCh38)
Location 20:60112616-60112638
Sequence CAGCATCAGCAGCAGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175582659_1175582665 7 Left 1175582659 20:60112586-60112608 CCCCATCTCTTGATCTCAGCCTC No data
Right 1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG No data
1175582660_1175582665 6 Left 1175582660 20:60112587-60112609 CCCATCTCTTGATCTCAGCCTCG No data
Right 1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG No data
1175582656_1175582665 27 Left 1175582656 20:60112566-60112588 CCCTTGCTGACCTGTGTTGACCC No data
Right 1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG No data
1175582661_1175582665 5 Left 1175582661 20:60112588-60112610 CCATCTCTTGATCTCAGCCTCGC No data
Right 1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG No data
1175582658_1175582665 17 Left 1175582658 20:60112576-60112598 CCTGTGTTGACCCCATCTCTTGA No data
Right 1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG No data
1175582657_1175582665 26 Left 1175582657 20:60112567-60112589 CCTTGCTGACCTGTGTTGACCCC No data
Right 1175582665 20:60112616-60112638 CAGCATCAGCAGCAGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175582665 Original CRISPR CAGCATCAGCAGCAGCACAG TGG Intergenic
No off target data available for this crispr