ID: 1175584287

View in Genome Browser
Species Human (GRCh38)
Location 20:60125739-60125761
Sequence CTGTTTCAGGATAAGATCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175584287_1175584293 5 Left 1175584287 20:60125739-60125761 CCGCAGATCTTATCCTGAAACAG No data
Right 1175584293 20:60125767-60125789 GTGCAAGTGTCCTCTTAGAAGGG No data
1175584287_1175584296 17 Left 1175584287 20:60125739-60125761 CCGCAGATCTTATCCTGAAACAG No data
Right 1175584296 20:60125779-60125801 TCTTAGAAGGGATCAACCATGGG No data
1175584287_1175584292 4 Left 1175584287 20:60125739-60125761 CCGCAGATCTTATCCTGAAACAG No data
Right 1175584292 20:60125766-60125788 GGTGCAAGTGTCCTCTTAGAAGG No data
1175584287_1175584295 16 Left 1175584287 20:60125739-60125761 CCGCAGATCTTATCCTGAAACAG No data
Right 1175584295 20:60125778-60125800 CTCTTAGAAGGGATCAACCATGG No data
1175584287_1175584297 23 Left 1175584287 20:60125739-60125761 CCGCAGATCTTATCCTGAAACAG No data
Right 1175584297 20:60125785-60125807 AAGGGATCAACCATGGGATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175584287 Original CRISPR CTGTTTCAGGATAAGATCTG CGG (reversed) Intergenic
No off target data available for this crispr