ID: 1175587015

View in Genome Browser
Species Human (GRCh38)
Location 20:60149134-60149156
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175587011_1175587015 8 Left 1175587011 20:60149103-60149125 CCTGATAGGATCTCAGGAGCTGG No data
Right 1175587015 20:60149134-60149156 GCCCAAGTATGTGCACTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175587015 Original CRISPR GCCCAAGTATGTGCACTAAA TGG Intergenic
No off target data available for this crispr