ID: 1175591311

View in Genome Browser
Species Human (GRCh38)
Location 20:60194084-60194106
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175591307_1175591311 -2 Left 1175591307 20:60194063-60194085 CCATACACAGTGGGAGAGGGGCA No data
Right 1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG No data
1175591296_1175591311 16 Left 1175591296 20:60194045-60194067 CCTCCCACCAACCCAAGACCATA No data
Right 1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG No data
1175591297_1175591311 13 Left 1175591297 20:60194048-60194070 CCCACCAACCCAAGACCATACAC No data
Right 1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG No data
1175591299_1175591311 9 Left 1175591299 20:60194052-60194074 CCAACCCAAGACCATACACAGTG No data
Right 1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG No data
1175591302_1175591311 5 Left 1175591302 20:60194056-60194078 CCCAAGACCATACACAGTGGGAG No data
Right 1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG No data
1175591303_1175591311 4 Left 1175591303 20:60194057-60194079 CCAAGACCATACACAGTGGGAGA No data
Right 1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG No data
1175591298_1175591311 12 Left 1175591298 20:60194049-60194071 CCACCAACCCAAGACCATACACA No data
Right 1175591311 20:60194084-60194106 CAATTTCCCCAAAGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175591311 Original CRISPR CAATTTCCCCAAAGGGAGAT GGG Intergenic