ID: 1175592036

View in Genome Browser
Species Human (GRCh38)
Location 20:60200798-60200820
Sequence GAGGTGTCCAGGTTCTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175592036_1175592042 20 Left 1175592036 20:60200798-60200820 CCCAGTGAGAACCTGGACACCTC No data
Right 1175592042 20:60200841-60200863 CTCGCTGTTTTTATTCTGCTTGG No data
1175592036_1175592040 -8 Left 1175592036 20:60200798-60200820 CCCAGTGAGAACCTGGACACCTC No data
Right 1175592040 20:60200813-60200835 GACACCTCAGATGCTGGCGCAGG No data
1175592036_1175592044 24 Left 1175592036 20:60200798-60200820 CCCAGTGAGAACCTGGACACCTC No data
Right 1175592044 20:60200845-60200867 CTGTTTTTATTCTGCTTGGTGGG No data
1175592036_1175592043 23 Left 1175592036 20:60200798-60200820 CCCAGTGAGAACCTGGACACCTC No data
Right 1175592043 20:60200844-60200866 GCTGTTTTTATTCTGCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175592036 Original CRISPR GAGGTGTCCAGGTTCTCACT GGG (reversed) Intergenic
No off target data available for this crispr