ID: 1175594981

View in Genome Browser
Species Human (GRCh38)
Location 20:60223863-60223885
Sequence ACCCCCTGGGAAGGCGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175594981_1175594987 -3 Left 1175594981 20:60223863-60223885 CCCTCACCGCCTTCCCAGGGGGT No data
Right 1175594987 20:60223883-60223905 GGTCTGCCCCCCAGAATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175594981 Original CRISPR ACCCCCTGGGAAGGCGGTGA GGG (reversed) Intergenic
No off target data available for this crispr