ID: 1175598688

View in Genome Browser
Species Human (GRCh38)
Location 20:60255571-60255593
Sequence CTGCTGCCACTGTGCACCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175598688_1175598693 -7 Left 1175598688 20:60255571-60255593 CCCGTGGTGCACAGTGGCAGCAG No data
Right 1175598693 20:60255587-60255609 GCAGCAGCTGGAATTAGGGCAGG No data
1175598688_1175598694 3 Left 1175598688 20:60255571-60255593 CCCGTGGTGCACAGTGGCAGCAG No data
Right 1175598694 20:60255597-60255619 GAATTAGGGCAGGCAGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175598688 Original CRISPR CTGCTGCCACTGTGCACCAC GGG (reversed) Intergenic
No off target data available for this crispr