ID: 1175604026

View in Genome Browser
Species Human (GRCh38)
Location 20:60297847-60297869
Sequence CTGTAAACACAGATGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175604025_1175604026 -10 Left 1175604025 20:60297834-60297856 CCATGGGGAGTGGCTGTAAACAC No data
Right 1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175604026 Original CRISPR CTGTAAACACAGATGAAGCA TGG Intergenic
No off target data available for this crispr