ID: 1175604073

View in Genome Browser
Species Human (GRCh38)
Location 20:60298283-60298305
Sequence CACTCACTCCTGAGGCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175604067_1175604073 3 Left 1175604067 20:60298257-60298279 CCAAAGTCAACGTGTCGGTGGGG No data
Right 1175604073 20:60298283-60298305 CACTCACTCCTGAGGCTCTGGGG No data
1175604063_1175604073 11 Left 1175604063 20:60298249-60298271 CCAGAAGTCCAAAGTCAACGTGT No data
Right 1175604073 20:60298283-60298305 CACTCACTCCTGAGGCTCTGGGG No data
1175604061_1175604073 27 Left 1175604061 20:60298233-60298255 CCCACAGTTCTGGGGGCCAGAAG No data
Right 1175604073 20:60298283-60298305 CACTCACTCCTGAGGCTCTGGGG No data
1175604062_1175604073 26 Left 1175604062 20:60298234-60298256 CCACAGTTCTGGGGGCCAGAAGT 0: 3
1: 32
2: 95
3: 239
4: 590
Right 1175604073 20:60298283-60298305 CACTCACTCCTGAGGCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175604073 Original CRISPR CACTCACTCCTGAGGCTCTG GGG Intergenic
No off target data available for this crispr