ID: 1175605339

View in Genome Browser
Species Human (GRCh38)
Location 20:60308075-60308097
Sequence CCTTCTTGGCAGTGTGCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175605339_1175605352 29 Left 1175605339 20:60308075-60308097 CCTGGTGCACACTGCCAAGAAGG No data
Right 1175605352 20:60308127-60308149 AGGCGGTAAAGGGATGGGTCAGG No data
1175605339_1175605346 12 Left 1175605339 20:60308075-60308097 CCTGGTGCACACTGCCAAGAAGG No data
Right 1175605346 20:60308110-60308132 GGATAGGGATCTCCTATAGGCGG No data
1175605339_1175605345 9 Left 1175605339 20:60308075-60308097 CCTGGTGCACACTGCCAAGAAGG No data
Right 1175605345 20:60308107-60308129 GCAGGATAGGGATCTCCTATAGG No data
1175605339_1175605351 24 Left 1175605339 20:60308075-60308097 CCTGGTGCACACTGCCAAGAAGG No data
Right 1175605351 20:60308122-60308144 CCTATAGGCGGTAAAGGGATGGG No data
1175605339_1175605347 18 Left 1175605339 20:60308075-60308097 CCTGGTGCACACTGCCAAGAAGG No data
Right 1175605347 20:60308116-60308138 GGATCTCCTATAGGCGGTAAAGG No data
1175605339_1175605343 -4 Left 1175605339 20:60308075-60308097 CCTGGTGCACACTGCCAAGAAGG No data
Right 1175605343 20:60308094-60308116 AAGGTGAAAAGACGCAGGATAGG No data
1175605339_1175605342 -9 Left 1175605339 20:60308075-60308097 CCTGGTGCACACTGCCAAGAAGG No data
Right 1175605342 20:60308089-60308111 CCAAGAAGGTGAAAAGACGCAGG No data
1175605339_1175605348 19 Left 1175605339 20:60308075-60308097 CCTGGTGCACACTGCCAAGAAGG No data
Right 1175605348 20:60308117-60308139 GATCTCCTATAGGCGGTAAAGGG No data
1175605339_1175605349 23 Left 1175605339 20:60308075-60308097 CCTGGTGCACACTGCCAAGAAGG No data
Right 1175605349 20:60308121-60308143 TCCTATAGGCGGTAAAGGGATGG No data
1175605339_1175605344 -3 Left 1175605339 20:60308075-60308097 CCTGGTGCACACTGCCAAGAAGG No data
Right 1175605344 20:60308095-60308117 AGGTGAAAAGACGCAGGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175605339 Original CRISPR CCTTCTTGGCAGTGTGCACC AGG (reversed) Intergenic
No off target data available for this crispr